Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SND2
Systematic Name YLR065C
Alias ENV10, SND2
Strain S288c
Description Putative protein of unknown function; YLR065C is not an essential gene
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SND2 YLR065C
GCCAAGAAGCAAGATCAATAAATGGGAACAGATTGAAATGAGACATCTTTCATATTTTAA
AGAACTGAGGAAATCTAAGAGAGTATTACCTGTGAGTAAATTCTAGAAATGCATATATCA
TATTGTATAATCAACTGCATATATATCAAAAAATCATGTAAATAATTAACAAAAATTGAG
AGAGCAAAGACTAGTCTAAACTTTGTTTTTATTTTCCACGGTCAGTGTATAGTTGCCTAC
AGTTTCACCGTAAGTTAGCAAACCTACCCATGGTTGAACATTCCAGTGTAACTTGAAAAC
CAAATCCTTGCCTTCGAATTTTCCATCTTCAATATCCCAGATAGAATACTTGGATCTTAG
ATCGTTCACATCAATCACAGCATCATCCTTGCTTTTTATGATCTTATCCCAAAATGTTAC
CTCACTTGTTATTTTTTCAGTACTGTTATACTCAGCAGTTAGATAGACAAAAACTTGCTT
TGTATTCCAATTGAATAGGGGAGTGAGATCTGTATTTAGATCAAATTTAATTTTCATATT
TTCCTTTGCCTTGCCTCTCTGTGAGCCAAAATATCTACTTGTTCTAACATTTATTAAAGT
TTTGACGTTATCGATATTACTAGGTACTGAGAACGCGTTATTATTGATTAATTGATAGTA
TGAGGATGCCATGATGAATACAACCATTACAATTCCCATTGAAAAGGCCTGGTTCGATAC
ATTCTGGAATCTTTGGACAAAGGAGAACATTGTTCTGGAGAAGTGCGGCAATGCTAGCTA
GCTTTGTGGGTCTTTGTCTCAGTGGAACTTAATAGGCTTAACAATCAACTTTTTTCTCCA
CGTCTACCGACTGTCATGAAATTAGTCGACCTTCGTTCTGCGCCTTTGAAATGAAAAATT
TCAACGTAATTAAAAAAAGATAATAGATGAAAAAAAGGTAGTATTCACGTGTGGCTTCAA
GAAGACACCAAAGGCAGTGGTCTAAGTTTGTGTTGGTAGA
Chr coordinates Chr XII from 266918-266373
w3c xhtml validator w3c css validator