Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PET309
Systematic Name YLR067C
Strain S288c
Description Specific translational activator for the COX1 mRNA, also influences stability of intron-containing COX1 primary transcripts; localizes to the mitochondrial inner membrane; contains seven pentatricopeptide repeats (PPRs)
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PET309 YLR067C
TTTAGTCATTACGCTCCAACAGCGCCCCATGTTCAAAAAGAATTGATATCTGAGTTCCAA
AAGAAGCAAGCGAAGAAATAGTCAAGTCCTCATGGGCAAAACAGTCTTGTAAATAACAAA
TTCCAATAAAAAGGAATTAACAAAAGGCAGGAAATAAAATTAATATACACACTAATTAAG
TAAATTTAAATAAAAAGATCTTTCTGTAAATACACGAATGAAAAGAAATTTTGAAGAATA
TCATTATCTAGGAGGTATAAGTATCATCCGTCTTAATTTTATCCAAAAGATCCTCTATCT
TAGGGCCCATCAAGGGCTGGCCTGTCCTTGTTCTTTGAGTCAATTTCTTCTTTCTATCTT
CTCTCCTCTGAAATTTTTCCTTCGAAACTCTGATTCTTTCCAATTGCTCGTTTCTTTGCT
TGTTTAATTCATCTTTTTGCATTCTCTTTCTTTGTTTCTTGATCTCCTTCTTCTCGTCTA
GTTTCTTCTTTCCCTCTATTGCCCTGGCTTCCTTAATCTTCCTTACAGATTCTTTTGCCA
CGGTTTTTGGTTCCTTTTCTGGTACGGCATACCCTTCATCTTTTAAAGCTTTAAGGTATT
CCTTTCTCAGTCTAGTTTTCTTTGTAATACTTCTTTGGATCTCCTTAACCTTATACTCCC
TCGTAAACTTCTTTCTATTTTGATTTTGCTTGGCTGTACCCATATTGATTTTGCTCAGTT
GCTTACTTGACCACCTTCCTGTATCATTCTTGTGAAAGCACTTTTAATACTATCGCGATG
AGGTTTGATTTTGAAATTTTTCATTGTTTGAAGGAAAAGTAACTTTTCGGGCCAATAGAG
AAATAAAAATAAAAAATCATGTAGTGTAAGTTAAAGTGGGATTTCTAGGTGACGCTAACG
CAGCCTCGATACCCAGGAAAGAGGCCGCAATAGTGTACAAAGCTTCGAATTTAAGTGATT
AAGGGTGTTGGAGTATACTGAAACACGCTTTTTGGCCATT
Chr coordinates Chr XII from 270710-267813
w3c xhtml validator w3c css validator