Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name BUD20
Systematic Name YLR074C
Strain S288c
Description Protein involved in bud-site selection; diploid mutants display a random budding pattern instead of the wild-type bipolar pattern
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>BUD20 YLR074C
TCCAAGTTGGTGAAACCCCACTTCTTAGACAAAATAATCTTTTGTTGACCTGGGAACTTG
TATCTGGCTCTTCTCAAACCTTCAACGACAACATCCTTGTTGCTGTCCTTGGTTCTGACA
GAGAAGATAATTTGACCAATGTCGACACGAGCGGCCAAACCGTGTGGCTTACCCCAAGCA
CCTCTCATACCTTGTTGCAATCTATCCGCACCGGCACAAGACAACATCTTGTTGATTCTC
AAGACATGGAAAGGATGGACTCTGACTCTTAAGTGGAAAGCATCTCTACCGGAGACAGTA
GTCATGTACTTGTTGGCACAGATACGAGCAGCTTCCAAAGCTTCAGAAGACAATTGTTCC
AATTCGTTGGAAACCAAATGGACACACAATGGGAATTCATCGACGGTAGCCTTCTTCTTA
CCCAAATCGTAGATTCTGATCTTGGAGTCTGGAACAGCTCTGTTGTATCTAGACTTTGGG
TAAGGCTTGTTCTTTTGGTATCTGTAACATCTAGCTGGTCTTCTAGCCATCTTGAATTAG
TTATTTGATATACTGTACTTTAAAGTTTGAAAGTCCCACTCCAAAAGCACTTGCGGAAAG
GATGTATAAATGGTTGCTCCACATCAACATCTTTTTATAAACTATTCTCTAGAGAAACCA
AACTGACCATCAATTCTGAGATGAAAAGTTTCCTTAGTCAGCATTATTGTGCTAACTAGT
TTCGGAGGGAAAAATATCGAAAAAAAAAAACCAAAAAAAAAAATAAAAAAAATGTACGGA
GGGAAAAGATGTACAGGTGTAAAAAAGCACCCCACGGAAATAACCGCTACTATAATTTCA
TTTCTTTTTTTTCTATATCCTGCGGAAAATTTTTTTATACTGACAGGGGAAAAAGCAAAT
TAATTTTGCTTTTATATATGGAAAGTAGCGGGAGATGAGATGAGGTGAATTGAAAGGCAG
TTAAACACACAGACAAGTGAAGATAAAACAATAGCGCATC
Chr coordinates Chr XII from 282456-281956
w3c xhtml validator w3c css validator