Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name Uncharacterized
Systematic Name YLR076C
Strain S288c
Description Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; partially overlaps the essential gene RPL10 which encodes the ribosomal protein L10
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YLR076C	6323105 upstream sequence, from -1000 to -1, size 1000
CACCCTTTTTATTCAAAGCGTACAAAAAGTGACTAGAATACTTCATTGAGGTCAAATCTT
GATCTGGCAATATCGTTTTTGTTTGTCCCAAATCATCCCACGATATCAAATCGCCTTTCT
CGTCAATTGCAAAATTGGTGTTGAAATCGTCAGAGGGAGCTAATAGGATATCTCTGAATT
TACGACCATCCAAATTAGGTACTCTAACAGGGAACAATGAGTCCTTAGAATGACACCTTC
CCCATATGTATACACCAGGATGATCTATTCCAAGTTGAAAGGCAGGCACTTGAGGAATCT
CCCTTAATAGATTTTTGGCCTTTTGTCTGATCAATTTTTCCAACGAATCCTGTCCACTTT
GCTCTTGCGTTGCATTTATGCGACCGCCATTCATCTTGATTAACCACCAGGATTTTAATT
CTGGCCAACGCAAGTAGGCCGTTCCCAACCCACCCACTACCACGAGAATGAGGATCCCTT
GCCCAACAGCAGATAATTTCGCCATCCTTTCCCATTGGAGTTCAGATTCCTTTGTGATCT
GATCAGGAGACTTCTCAGGCCATTGGAAATGCTCGTCTGATGGCCTTTTCTTTGCTTTAT
ATGCGCCATGGTTAATGTTCTCTGCAAACAACTCTGCTTCATCGTATTGAGGTTGTTTGG
CGTATCGCCTGATGGGACTAACCCAGTTAAGGCGAGGGAGACGTTGAGAAGTCCTCGTGA
ATAATCTGAATGACATTAGCGGCGCACGTCCCTGTTATCGATTGCTCCCTTTCTTGTTAG
ACGCATTCAACAATTCTTCGTTACTGCAGCTCAGGCTTTTTTTTTTCCTGCTGGTATACA
AAAAGCAACAGTGTCCATTGACTTCAGGATATATCACTACCCAACATGCTGAACTTTAAA
AAAACACATAATTATATGTATTACAATAATGTATAAATATATTTACTGTTTAATAAACTA
GAATTTAAATCAAAAAAATTTCTCTTTTAAGTTAGTTCAA
Chr coordinates
w3c xhtml validator w3c css validator