Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name EMP46
Systematic Name YLR080W
Strain S288c
Description Integral membrane component of endoplasmic reticulum-derived COPII-coated vesicles, which function in ER to Golgi transport
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>EMP46 YLR080W
ACCCCCCAAAAGCCTTCACAGAACCTAGTCCCTGTCACTCCCTCAACAACTAAGTCTTTT
AAAAATGCGCCATTATTAGCACCTCCCAATTCGAACATGGGTATGACCTCTCCATTTAAT
GGGCTTACGTCTCCTCAACGCTCGCCGTTTCCAAAATCTTCAGTGAAGAGGACACTATTC
CAATTTGAAAGTCATGATAATGGAACAGTAAGGGAAGAGCAGGAACCATTGGGTCGTGTA
AATAGGATATTGTTTCCCACGCAGCAAAATGTGGATATAGATGCAGCAGAAGAAGAAGAA
GAAGGAGAAGTTCTTCTTCCCCCCAGCAGACCTACATCTGCCAGGCAGTTACATTTATCA
CTTGAAAGAGATGAGTTTGATCAGACACATAGAAAGAAGATTATTAAAGATGTACCTGGT
ACGCCCAGCGACAAGGTGATAACATTTGAATTGGCAAAAAATTGGAACAACAACTCTCCG
AAAAATGACGCCAGGAGTCAAGAAAGTGAAGACGAGGAAGACATCATCATCAATCCAGTG
CGGGTGGGTAAAAATCCCTTTGCATCAGATGAACTGGTCACTCAGGAAATTAGAAATGAA
CGTAAAAGGGCAATGTTGAGAGAAAACCCAGATATAGAAGACGTAATAACATATGTCAAT
AAGAAGGGAGAGGTGGTAGAGAAACGAAGGTTAACGGATGAAGAAAAGAGAAGATTCAAG
CCAAAGGCATTGTTTCAATCTAGGGATCAAGAGCATTGAAGAAATGAAAAAAAAAAGTTT
CTGGAACGATTATATTTTATTTACTTACTTATTCTACATTTATTTGCAAAGGGGCATTAA
CATCAACATTTTACATATTATAATATATACAGGATATTCTATATTACAACATTAACAGGA
TTTTTAACTTTTCCTTACCGTATTCTTTTATTCTGGTTTTCTGTCTTCAGAATAATAGCA
TATTTCATTGTAGTATTTCGTCAAAGCGAGTTAGGGGAGG
Chr coordinates Chr XII from 287916-289250
w3c xhtml validator w3c css validator