Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SRL2
Systematic Name YLR082C
Strain S288c
Description Protein of unknown function; overexpression suppresses the lethality caused by a rad53 null mutation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SRL2 YLR082C
AGACAAACCAAATCGCAAGACAAATACCCTTCCAGCCTTGGTATTTAAAGACTATACCAG
CTACTTTGATTGCTGGTATCTTTCCATTTGGCTCCATCGCCGTTGAGTTGTATTTCATAT
ACACAAGTTTATGGTTTAATAAGATTTTTTACATGTTTGGTTTCCTCTTTTTCTCTTTCC
TCCTATTAACTTTGACAAGTTCACTCGTCACTATTTTGATCACTTATCATTCCTTATGCC
TGGAGAACTGGAAGTGGCAATGGAGAGGATTCATAATTGGAGGCGCCGGTTGTGCTTTGT
ATGTGTTTATTCATTCTATTTTATTCACCAAATTTAAGTTGGGTGGATTCACGACTATTG
TCTTATACGTGGGATACTCCTCAGTCATTTCATTACTCTGCTGTTTGGTAACGGGGTCAA
TTGGCTTTATCAGCAGTATGCTCTTTGTTAGAAAAATCTACTCATCCATTAAAGTTGACT
AGGCCAACGAAAAAGAGGTCCTATATGTTGGGTTAGGGCGTTTTTTATTTATTTCTCTAC
TGTTTATCTTTTTTAACAAAGAAAATGCTAGGCCCTATGGCCTTTGGACATGATACATAG
TTTTTAGTAATATTTTTTTCAAAAAGATTAAAAGTACTATAGGATTCGAAGTTGTAATTT
TTGGTGTATATACATTTATTTATTTGAATCTTTTTTCCATGATTCTGGAATGACATTCTG
CGTTACAGTTTGGGAATAAATGCTCCTTTAAGGAAATAATATACAGCTTTAGTGTACAGG
GTTAATCTATAGCCACATTAAAAGGACTTGATTATGACTTAAAATAAGTGACACTGACGC
TTTAATATTCAGTCCGGGTGATGCTGTCATCTAGGACAAAACAATGGGAGTGGATAAGTA
AGCAAGTAATAAGATAAAACAGTATTAGAAATTGGTAGTAGGCTGAAGCTTGTTGAAGCT
GGTGGACAGAAAAACGCTTATATTGTGAAGATCCTTTTGG
Chr coordinates Chr XII from 293572-292394
w3c xhtml validator w3c css validator