Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CSF1
Systematic Name YLR087C
Strain S288c
Description Protein required for fermentation at low temperature; the authentic, non-tagged protein is detected in highly purified mitochondria in high-throughput studies
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CSF1 YLR087C
ACACAACAGCAGCTTCAATGGAACCACCAGTCAAATCTAAGGAAGTATGGTATGCCTCAA
CCCATGATCTTAATGCTGCACGAGGATTTTCGCTGAAGACAACAATTATATTCTTGGACC
ATACTGGCCAACGTGAGAAAAATCTTGCTAAAGATACACCCAAAGCTGCGCCGCCAATAT
TGAATTCATCATCTGAATTAAACCATGGAACGGCAAGCACCATCGCTTCTGTTCCATCAC
CCCTAGGAGCGTGCATTACACCGTACAATGTTTCTCCATATTGTTCATTTTCGTAAATAG
CAGTCTTAGTACCAAATTCTTGTAACCAAGAACCCATCAAATTGTTTCTTTCCATAGAAG
TCATGTTTACCATTTCTTTAATTTGAGATCGATAGCCCCTCAAAATGTTCCATTCAGATT
CTCTAAAGTAACTATACGCTTGTGAAGGCATCAATGCATTCTCAGAAATGTATGTTCTTC
TGTACTGTCCATCCATAGGCAGAATAGCTATAGAAATAAACCCAAATAGAGCGCATAGCA
TGGAAATAACTGGTAATAAGGCGATTATACGCGGGACAAGCCCCATATCAACAATCCTTC
GATGCAACTTCTCCAATAAGGCCATTCTTGGTGTATTATACGCGTCTTTGGTCTGTCAAG
TCCTTTTATAAGACAGCAAATGTCATTTCTTTCTAAGTGTAGCCGGCGTGTATTGTTTAT
GACTTTTTTTTCTACCGCTGGCATTAAAGTGAGAGGTTCACGATGCGTTCCCAATAACTT
CGTAGGGATGGCGATCAATATACAAATAGAGGGAAGCCAAACTCCCCACTATAAAGCTGT
TGGCACGGTTTTATAAGCTTCAACCTTTCTAGGCTACAGGATACTCAAAAAAAATTACTG
CGGTATTATCAACATAGTGCTCTTTGGAAAAAAAAAAAGAATAGTACTCATTAAAGCCAC
CTGACTCAAGTCTTCTATTGACGGTAATAAGTTAGCAAGC
Chr coordinates Chr XII from 315731-306855
w3c xhtml validator w3c css validator