Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SUL2
Systematic Name YLR092W
Strain S288c
Description High affinity sulfate permease; sulfate uptake is mediated by specific sulfate transporters Sul1p and Sul2p, which control the concentration of endogenous activated sulfate intermediates
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SUL2 YLR092W
CGCTCCCACGACATGCGCATCTCTTCCAAAAACACTACCACTTTCTACTGACTCACTGGC
CATTTGAGAACCACAGAGACTTGGTAGATTCCATCGCTGTAAACAATGGGAAACTAAATT
CAACGTCTTCAAGGAGCGTCTGGCTGAAGGCGGATTGGATAACACTGTTTAACGTTAAAA
ACCCTTGGGTCCAAACGCCGCCATCGTTAATGCGTCTGAGTGGGACAGATCTTGATACCT
TCACACCAGAGAGGATATTCCTGATAAATTCTCTTGGAAACCACTACAAATTTTTAATAG
CGAACAGTCATCTAAGCTACAATCACAAAAAATACCCCTCCCCTGGCGTGCAAATTCCTG
TCAGGAACGCTCTTGGCGAAGTTTCTCCGGCCAAACAAATTGCCCAACTTTTCGCAAGAC
AGCTGTCTCATATTTACAAGAGCCTCTTCATAGAAAACCCCCCGCTCTCTCCTGAGAACG
AGCTGGCATTGACTGCCGTCTTCTATGACGAGACTGTAGAGCGACGCCTTAGAAGGCTCT
ATATGCGAGCTTGTGCAAGGGCATATACGACTACTAATGCCGACTCCACCACGGAGCCTT
TGATGTTTCATTGCACCCGGTGGGAAGTTGATTAGTTGTTGTTGGCTGTTATACTGGAGT
AAATGTCACGTGCCACTGTGGCCGTGTCAGGTCACGTGAAGAGAGAAATTCGGCCACAGT
TGTGGTCCTAAACAAGGACTGAAAAAGATCGCAGAAACTAGCAACGTCGGATAGCGGTAT
GGTTGAACCAAAGTCCAGTTTTTAGTCATAGCCGGTTGAGGGATGATCTGCCGTTCAGTG
TTCTGCGTTCAATAATACGCATATATATATATATCAAGGTATCAACACAATACTTGAACA
GGTTAGGCTCGTACTAAAGCCTGGAAGTTTTTATCTTTCTGTAACATTTTTCTTTCTTGA
GGTGTGTGTGTGTATAGATTAGCAGGGAATTATCTAAGAT
Chr coordinates Chr XII from 323544-326225
w3c xhtml validator w3c css validator