Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ICT1
Systematic Name YLR099C
Strain S288c
Description Lysophosphatidic acid acyltransferase, responsible for enhanced phospholipid synthesis during organic solvent stress; null displays increased sensitivity to Calcofluor white; highly expressed during organic solvent stress
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>ICT1 YLR099C
ATGTGGACAAACACTTTCAAATGGTGCAGCAAAACTGAGAAGGAGACCACTACTGCAGAC
GCCAAGGTGTGTGCTAGCGTGCAGGGCCTGAAGGCCCTGCAGCAGCAAATTATGGATAGC
ACCACTGTGCGTGGGTCCGTTAATAACACGATGACTCCAGGCGGGATTAACCAGTGGCAT
TTCCACAATAAGCGTGCGAACAAAGTGTGCACGCCTACAGTACTAATCCATGGATACGCT
GCCTCGTCGATGGCGTTCTACAGGACGTTTGAGAACCTGTCAGACAACATTAAAGATCTA
TATGCCATCGACTTGCCAGCCAATGGTGCCTCAGAGGCGCCAGCATTGCAAGTGAACAAA
ACCAAGAAGATCAAGTCTCTCAGGTTTAAGCATATAGAAGATGACGTAGTAATCCCTGTG
ATAGAGAAGCGCCCCCCAGCAGAGGACATCAAGTCACACCTGGAGCAGTACGAAAGCTAC
TTCGTAGACAGGATAGAGCAATGGCGGAAGGATAACAAGCTTCGCAAAATAAACGTGGTG
GGCCATTCATTCGGAGGATATATTTCATTCAAATACGCCCTCAAGTACCCTGATTCCATT
GAGAAACTGTGTCTCATATCTCCTCTTGGTGTGGAAAACAGTATACATGCTATCACCCAC
AAATGGGAGCCCAACACCACCTATCCACTTACGTTTACCGACCCATCGTCCCGATATTAT
ACAAGAAAGCTGAACGTACCGCGGTTTATCTTTGAAAACCAGCTAAACGTTTTGAAGTGG
ATGGGACCCATAGGCTCCAAATTGTGCTCGAACTACATCTCCACCGCATACGTAAAAGTT
CCGGATCAGATATATAAGGACTATCTTTTGCACTCATTTGTCGGGAAGAACCAGACGGTG
CAACCACAGACAATCAAGGTGTTCACCCATTTGTTTGAAAGGAATCTGATCGCTAGAGAT
CCGATAATAAACAACGTTCGTTTTTTGAACCCAGCAACGCCTGTCATGTTCATGTATGGC
GAGCACGATTGGATGGATAAATATGCGGGCTACTTGACTACTGAATCAATGCTAAAAAAC
AAGGCAAAGGCTAGCTACGTTGAAGTCCCTGATGCTGGCCATAATCTTTTCCTGGACAAC
CCGCAGCACTTTGCCTCTTCTTTAGTCTCGTTCCTGTCAAAGTAA
Promoter Sequence
Download FASTA
>ICT1 YLR099C
CTAGAAGTCACCACAATGGTCAATCTGACATTGGTGTCCTCAGTTTCAATCAGACGGAAC
ACAATGTTCAGACCAAGATTACTATTAGTACCCGTTACGATAGCTACTTTCCTGTTCATC
CTATCCTCCTACTTTTTCTCTTTGCTACTTTTTTTCGACACAGATCATGTGCTTGTTTCT
CGTCCTATCTTTTAAATACCTGCTCAATTCAAGATGCCGTTCTTTCGTTAAACGACCATA
AATAAAGGCCCACGTACTATCGGAGATAAAACAACGGGTGTGCGAAAAGTGCCATTTATC
TGTTATAACTGCTATATGCGGATACATAAACAACAAACACTTATACAAAGTGTTCAATGA
ACCTACTCCATAGAGTCTTGGCCATTCTCCTACCTATATACTTGCCCAGCAGGGGCAGCA
GGACCCAGTTGAGCAGCTTGTTCAACTGTTGCAGCGACTCTTCCCATTGACGCTGTGCAT
CTGCGAGCTCGTTGCTGAGTGACGTGTCCTCGTCGCTGAGGTAACCATCTTCTTCCAGGC
CCTCCACGCTGTTGATTGTGTCGATGCCCTGCAGGATCACAGAGGTATCCTCGCTATCTG
CCATGTTCTAGTTATTGTTGCTCGTGCAGTGATGTGCTGTGGTGCTGGGGAGTGGTTTGC
TCTGCCGATCTTGCTTGTAACGGCCGGCCGTTAAATGGGCCTTCGGGGTCCAAACGAGGC
GCGGTTTCGTGAATCTTGCTTGGCTGTTTTTGGCTTGTTAATCCCAATTTGCGATAGTTT
ACGTTTCCACGGGGCACTGCTCAACGGGTTTAGTTCCGTGGAGCAGATGTGTTGCAGATA
CTAGTTGATATTTATGTTGATGTTGATCATTCTTGTGGCACAAAAGTATAAATAAAGCAG
CGTGCTCTTTTTTGTACGTGGAGTAGTAGAAGTATATTCGCAGGTCTTTCTCTCATTGTT
CAGGACATATACATACGTAAGCGTAGTTTTCTTCAGTAGA
Chr coordinates Chr XII from 340928-339744
w3c xhtml validator w3c css validator