Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SEN2
Systematic Name YLR105C
Strain S288c
Description Subunit of the tRNA splicing endonuclease, which is composed of Sen2p, Sen15p, Sen34p, and Sen54p; Sen2p contains the active site for tRNA 5' splice site cleavage and has similarity to Sen34p and to Archaeal tRNA splicing endonuclease
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SEN2 YLR105C
CATGAGCCAAGTGAACTACATTCCAGATCAGTATGGCAATCCGCAATTAAAGATTACCAA
ATACTTGGACACATTTCCTTTTGAATTTTATGTTGTTGTACACGATATAAGCGAACTACC
CGAAATGCTTTCACTGATTTTGCGTCAATACTTTACAGACCTGGCATCCAGCTAAGTATA
TCGTGAAAACCAAGAAGAGGAGGTTTACTACACGAATCAAAGGAACAAAAAAATCATGGA
ACTGAAAAAAAAAAAAAAAAACTACTGTAAAAAACTACTGTAAACTATAAATTATTAATT
AGACTGAACGTATACCTATATAAACCTGATATAAAAATGATTCAAGTTATTAGTCCTTTG
CATTTTCTGTTAGCAATCCTTTGTCAATTAGCCCTAAGAAATATTATTCCCATATGGGTA
ACCAACTCTCTTTTTTTTTTTTTTTGAAGGGATCAATACTTCAGTCAGATATTTAAAGAG
AAAAATTTTCTTCAAGATGCAAGTTTCCCATTCAGTTCTATAGGAAGTTAAAACAAAAGA
GCTGTTTGAGAGCTCGTAGGCTTTGGTTGTTAAGAGAACGGACTAAATAACACCAGGAGG
TGTGTCTAGACTTAGTTGAACGAGTTTTTTCTCGTGCTATTATATCTGTTCTTAATACTT
CCACTTTATTTTAATGATGATAGCATGATTTATGTTGCTCGAAGTTAATCGATGTGAGCA
CAATGATTTCTCAAGACTACAACGGTATCTGAATTTTATTTCTTGTCAAAAATGTTTTAT
AGAAGCCACTCTTGCTATAGATTTATATTGCCACACATAACTTTTTCACGTAAATTTGAA
AGAGCTATATTAGCTGGTGCTTTCACTAACATCTCTTTGCTCTAGTATTTCATTTCGGTG
CATAAAACATTTGAACTTCCATCGAAATTCAATATGCTAAAACGTTTCATTGTAACACGA
CGCTGAAAAGACAATAAGTACGAAGGACTCAAGAAGGAGC
Chr coordinates Chr XII from 348180-347047
w3c xhtml validator w3c css validator