Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YLR108C
Systematic Name YLR108C
Strain S288c
Description Protein of unknown function; green fluorescent protein (GFP)-fusion protein localizes to the nucleus; YLR108C is not an esssential gene
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YLR108C YLR108C
GCAAACTTGATGTGTGTGGTGTCCTTAACACCTAAACTCTTAGCCCACGCTTGGTTAGCG
AACGGGTTGTCAACAGTAACAACGATCACTTGGTCAACTTCCTTTTCCTTAACTAATTCA
TCCAAGTAGTTGATGTAACCTGGAATATGGCTGACAGTACAGGTTGGGGAGAAAGCAGCT
GGAGCACCGGTAATGATAACCTTCTTGTTTTCAGAAATTAATTTGGACCATTCAACTGTT
TGTGGCATCTTACAAGATTCACTGTCAGCATCACTTTGGCTGATAGCAATGTATTGGAAT
TTGTAGTCGCCAGCTGGGAATTTCTTGTTAACTAAGTCAGACATGTTTTGTTGTGGTTAT
TGGTAGTACTTGTGTTGTTCTGGTTTGTTGAAATTTCGTTATAAAGAAACGGTATATGCA
CAATTGGCAAGGGAGAGGAAATTGTGCTCCTTTATATAATGTTTCGTTTATGCTTTTCCC
TTACATCTCGTCCTTAATTTTCCACCCCTTTATTTTTCATTTAACCTCTCAACAATATGT
GAATACCGTCCGGAAGGGGTGTGGAAAAAGAAAAAGAATGATACAGAAGAAAATCAAAAG
ATGATATTCAACTTCATCACCAAATACTGACCTTTTTGGCCAGAGCTCCCCGTATAATTA
CAAATCAGAAAAAATCCGCGCTCACTACCTTAACGGAAGGAAATATTCCACATGTCGGAT
TAATTTTTCTCTGGTCCCATGACCATGTGCCGAAATCTTTTCAGTGACGTCAGGACCGGT
TTTTCCGAGAGCCCCACAGGGGACGCCGATGATTTAGGGTTCTTTTCTTGATTACTAATA
GACAACATAAGCGCAATAGATCGAGGCCAAGGTGGTGGTTTATAAATTGTATTACCTTAA
AGGCTCATTATTAGCTTGAACACGAATATCCAAAGAACACGAACAACTTCAGGACGTGGA
TAGACAAGTGTAAAGTCACTCACACGCACGCTCATATCAG
Chr coordinates Chr XII from 368124-366667
w3c xhtml validator w3c css validator