Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name AHP1
Systematic Name YLR109W
Alias cTPxIII
Strain S288c
Description Thiol-specific peroxiredoxin, reduces hydroperoxides to protect against oxidative damage; function in vivo requires covalent conjugation to Urm1p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>AHP1 YLR109W
TCTTTTATGAGTTTAACTAACTTGGGTAACTGAAAATATAATGCGTCCGCGAAAAGACAG
GTAAATTGTACTTCGTTCTTAATATCGGGAAAATAACCTTGTAAATGTCTGTATATTATG
ATGAACACGTCTTCCGATCTATCAACAAATAGAATCGTATTTTTATCGTGCGTATTGAAG
AATTGGGTGAAAAAATTGGGCGCATCCGAATTCAATGTAGCACCTGAGATCTCAAATAGC
TTTTGGCCAATCCTAATCTTGAAAACTTCATGGTTTGGTAAAAGCTCGGGGGTAGTTTCT
AACTCTTTTGTATAAACCACGATCTCGCCCTTTTGGCCAGACATCTGATATGAGCGTGCG
TGTGAGTGACTTTACACTTGTCTATCCACGTCCTGAAGTTGTTCGTGTTCTTTGGATATT
CGTGTTCAAGCTAATAATGAGCCTTTAAGGTAATACAATTTATAAACCACCACCTTGGCC
TCGATCTATTGCGCTTATGTTGTCTATTAGTAATCAAGAAAAGAACCCTAAATCATCGGC
GTCCCCTGTGGGGCTCTCGGAAAAACCGGTCCTGACGTCACTGAAAAGATTTCGGCACAT
GGTCATGGGACCAGAGAAAAATTAATCCGACATGTGGAATATTTCCTTCCGTTAAGGTAG
TGAGCGCGGATTTTTTCTGATTTGTAATTATACGGGGAGCTCTGGCCAAAAAGGTCAGTA
TTTGGTGATGAAGTTGAATATCATCTTTTGATTTTCTTCTGTATCATTCTTTTTCTTTTT
CCACACCCCTTCCGGACGGTATTCACATATTGTTGAGAGGTTAAATGAAAAATAAAGGGG
TGGAAAATTAAGGACGAGATGTAAGGGAAAAGCATAAACGAAACATTATATAAAGGAGCA
CAATTTCCTCTCCCTTGCCAATTGTGCATATACCGTTTCTTTATAACGAAATTTCAACAA
ACCAGAACAACACAAGTACTACCAATAACCACAACAAAAC
Chr coordinates Chr XII from 368781-369311
w3c xhtml validator w3c css validator