Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CCW12
Systematic Name YLR110C
Strain S288c
Description Cell wall mannoprotein with a role in maintenance of newly synthesized areas of cell wall; localizes to periphery of small buds, septum region of larger buds, and shmoo tip
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CCW12 YLR110C
AACCAGGGCAAAGCAAAATAAAAGAAACTTAATACGTTATGCCGTAATGAAGGGCTACCA
AAAACGATAATCTCAACTGTAAACAGGTACAATGCGGACCCTTTTGCCACAAAACATACA
TCATTCATTGCCGGAAAAAGAAAGAAGTGAAGACAGCAGTGCAGCCAGCCATGTTGCGCC
AATCTAATTATAGATGCTGGTGCCCTGAGGATGTATCTGGAGCCAGCCATGGCATCATGC
GCTACCGCCGGATGTAAAATCCGACACGCAAAAGAAAACCTTCGAGGTTGCGCACTTCGC
CCACCCATGAACCACACGGTTAGTCCAAAAGGGGCAGTTCAGATTCCAGATGCGGGAATT
AGCTTGCTGCCACCCTCACCTCACTAACGCTGCGGTGTGCGGATACTTCATGCTATTTAT
AGACGCGCGTGTCGGAATCAGCACGCGCAAGAACCAAATGGGAAAATCGGAATGGGTCCA
GAACTGCTTTGAGTGCTGGCTATTGGCGTCTGATTTCCGTTTTGGGAATCCTTTGCCGCG
CGCCCCTCTCAAAACTCCGCACAAGTCCCAGAAAGCGGGAAAGAAATAAAACGCCACCAA
AAAAAAAAAAATAAAAGCCAATCCTCGAAGCGTGGGTGGTAGGCCCTGGATTATCCCGTA
CAAGTATTTCTCAGGAGTAAAAAAACCGTTTGTTTTGGAATTCCCCATTTCGCGGCCACC
TACGCCGCTATCTTTGCAACAACTATCTGCGATAACTCAGCAAATTTTGCATATTCGTGT
TGCAGTATTGCGATAATGGGAGTCTTACTTCCAACATAACGGCAGAAAGAAATGTGAGAA
AATTTTGCATCCTTTGCCTCCGTTCAAGTATATAAAGTCGGCATGCTTGATAATCTTTCT
TTCCATCCTACATTGTTCTAATTATTCTTATTCTCCTTTATTCTTTCCTAACATACCAAG
AAATTAATCTTCTGTCATTCGCTTAAACACTATATCAATA
Chr coordinates Chr XII from 370098-369697
w3c xhtml validator w3c css validator