Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CCW12
Systematic Name YLR110C
Strain S288c
Description Cell wall mannoprotein with a role in maintenance of newly synthesized areas of cell wall; localizes to periphery of small buds, septum region of larger buds, and shmoo tip
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>CCW12 YLR110C
ATGCAATTTTCTACTGTCGCTTCTATCGCCGCTGTCGCCGCTGTCGCTTCTGCCGCTGCT
AACGTTACCACTGCTACTGTCAGCCAAGAATCTACCACTTTGGTCACCATCACTTCTTGT
GAAGACCACGTCTGTTCTGAAACTGTCTCCCCAGCTTTGGTTTCCACCGCTACCGTCACC
GTCGATGACGTTATCACTCAATACACCACCTGGTGCCCATTGACCACTGAAGCCCCAAAG
AACGGTACTTCTACTGCTGCTCCAGTTACCTCTACTGAAGCTCCAAAGAACACCACCTCT
GCTGCTCCAACTCACTCTGTCACCTCTTACACTGGTGCTGCTGCTAAGGCTTTGCCAGCT
GCTGGTGCTTTGTTGGCTGGTGCCGCTGCTTTGTTGTTGTAA
Promoter Sequence
Download FASTA
>CCW12 YLR110C
AACCAGGGCAAAGCAAAATAAAAGAAACTTAATACGTTATGCCGTAATGAAGGGCTACCA
AAAACGATAATCTCAACTGTAAACAGGTACAATGCGGACCCTTTTGCCACAAAACATACA
TCATTCATTGCCGGAAAAAGAAAGAAGTGAAGACAGCAGTGCAGCCAGCCATGTTGCGCC
AATCTAATTATAGATGCTGGTGCCCTGAGGATGTATCTGGAGCCAGCCATGGCATCATGC
GCTACCGCCGGATGTAAAATCCGACACGCAAAAGAAAACCTTCGAGGTTGCGCACTTCGC
CCACCCATGAACCACACGGTTAGTCCAAAAGGGGCAGTTCAGATTCCAGATGCGGGAATT
AGCTTGCTGCCACCCTCACCTCACTAACGCTGCGGTGTGCGGATACTTCATGCTATTTAT
AGACGCGCGTGTCGGAATCAGCACGCGCAAGAACCAAATGGGAAAATCGGAATGGGTCCA
GAACTGCTTTGAGTGCTGGCTATTGGCGTCTGATTTCCGTTTTGGGAATCCTTTGCCGCG
CGCCCCTCTCAAAACTCCGCACAAGTCCCAGAAAGCGGGAAAGAAATAAAACGCCACCAA
AAAAAAAAAAATAAAAGCCAATCCTCGAAGCGTGGGTGGTAGGCCCTGGATTATCCCGTA
CAAGTATTTCTCAGGAGTAAAAAAACCGTTTGTTTTGGAATTCCCCATTTCGCGGCCACC
TACGCCGCTATCTTTGCAACAACTATCTGCGATAACTCAGCAAATTTTGCATATTCGTGT
TGCAGTATTGCGATAATGGGAGTCTTACTTCCAACATAACGGCAGAAAGAAATGTGAGAA
AATTTTGCATCCTTTGCCTCCGTTCAAGTATATAAAGTCGGCATGCTTGATAATCTTTCT
TTCCATCCTACATTGTTCTAATTATTCTTATTCTCCTTTATTCTTTCCTAACATACCAAG
AAATTAATCTTCTGTCATTCGCTTAAACACTATATCAATA
Chr coordinates Chr XII from 370098-369697
w3c xhtml validator w3c css validator