Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YPS1
Systematic Name YLR120C
Alias YAP3
Strain S288c
Description Aspartic protease, member of the yapsin family of proteases involved in cell wall growth and maintenance; attached to the plasma membrane via a glycosylphosphatidylinositol (GPI) anchor
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>YPS1 YLR120C
ATGAAACTGAAAACTGTAAGATCTGCGGTCCTTTCGTCACTCTTTGCATCGCAGGTTCTC
GGTAAGATAATACCAGCAGCAAACAAGCGCGACGACGACTCGAATTCCAAGTTCGTCAAG
TTGCCCTTTCATAAGCTTTACGGGGACTCGCTAGAAAATGTGGGAAGCGACAAAAAACCG
GAAGTACGCCTATTGAAGAGGGCTGACGGTTATGAAGAAATTATAATTACCAACCAGCAA
AGTTTCTATTCGGTGGACTTGGAAGTGGGCACGCCACCACAGAACGTAACGGTCCTGGTG
GACACAGGCTCCTCTGATCTATGGATTATGGGCTCGGATAATCCATACTGTTCTTCGAAC
AGTATGGGTAGTAGCCGGAGACGTGTTATTGACAAACGTGATGATTCGTCAAGCGGCGGA
TCTTTGATTAATGATATAAACCCATTTGGCTGGTTGACGGGAACGGGCAGTGCCATTGGC
CCCACTGCTACGGGCTTAGGAGGCGGTTCAGGTACGGCAACTCAATCCGTGCCTGCTTCG
GAAGCCACCATGGACTGTCAACAATACGGGACATTTTCCACTTCGGGCTCTTCTACATTT
AGATCAAACAACACCTATTTCAGTATTAGCTACGGTGATGGGACTTTTGCCTCCGGTACT
TTTGGTACGGATGTTTTGGATTTAAGCGACTTGAACGTTACCGGGTTGTCTTTTGCCGTT
GCCAATGAAACGAATTCTACTATGGGTGTGTTAGGTATTGGTTTGCCCGAATTAGAAGTC
ACTTATTCTGGCTCTACTGCGTCTCATAGTGGAAAAGCTTATAAATACGACAACTTCCCC
ATTGTATTGAAAAATTCTGGTGCTATCAAAAGCAACACATATTCTTTGTATTTGAACGAC
TCGGACGCTATGCATGGCACCATTTTGTTCGGAGCCGTGGACCACAGTAAATATACCGGC
ACCTTATACACAATCCCCATCGTAAACACTCTGAGTGCTAGTGGATTTAGCTCTCCCATT
CAATTTGATGTCACTATTAATGGTATCGGTATTAGTGATTCTGGGAGTAGTAACAAGACC
TTGACTACCACTAAAATACCTGCTTTGTTGGATTCCGGTACTACTTTGACTTATTTACCT
CAAACAGTGGTAAGTATGATCGCTACTGAACTAGGTGCGCAATACTCTTCCAGGATAGGG
TATTACGTATTGGACTGTCCATCTGATGATAGTATGGAAATAGTGTTCGATTTTGGTGGT
TTTCACATCAATGCACCACTTTCGAGTTTTATCTTGAGTACTGGCACTACATGTCTTTTA
GGTATTATCCCAACGAGTGATGACACAGGTACCATTTTGGGTGATTCATTTTTGACTAAC
GCGTACGTGGTTTATGATTTGGAGAATCTTGAAATATCCATGGCACAAGCTCGCTATAAT
ACCACAAGCGAAAATATCGAAATTATTACATCCTCTGTTCCAAGCGCCGTAAAGGCACCA
GGCTATACAAACACTTGGTCCACAAGTGCATCTATTGTTACCGGTGGTAACATATTTACT
GTAAATTCCTCACAAACTGCTTCCTTTAGCGGTAACCTGACGACCAGTACTGCATCCGCC
ACTTCTACATCAAGTAAAAGAAATGTTGGTGATCATATAGTTCCATCTTTACCCCTCACA
TTAATTTCTCTTCTTTTTGCATTCATCTGA
Promoter Sequence
Download FASTA
>YPS1 YLR120C
CAGACCAGTGTGGGGACCTGTGTCTTGGCAATAATTCCACAAGCGGGCAACGCCACCGCT
ATCCTTGGTGATTCCTTCTTGAGAAACGCCTACGTGGTCTACGATTTGGATAACTACGAG
ATTTCCCTAGCTCAAGCCAAGTATGGCACGGGGAAAGAGAACGTCGAAGTCATCAAATCT
ACCGTTCCCAGTGCAATAAGGGCCCCCAGTTACAACAACACTTGGTCTAACTACGCCTCC
GCCACGTCCGGTGGTAATATTTTTACCACCGTGCGCACTTTCAATGGCACCAGTACTGCC
ACCACTACGAGGTCAACCACCACCAAGAAGACAAACTCTACCACTACTGCAAAGTCGACT
CATAAAAGCAAGAGGGCACTCCAGAGGGCTGCTACCAACTCCGCTTCCAGTATACGCTCT
ACCTTGGGTTTACTGCTAGTCCCCTCCTTACTCATCCTTTCCGTTTTCTTTTCGTAAAAA
AAAACAATAGACACTATATATAGACACTTTTTCCTTTCCTTCTTTGCGCGATTTCAAGAG
GAAAAGCATACTTAAATAAGAATATTCCTAAAACACACGTTCTGACGCGTCAATTAGATC
GTCAGACCTTGCATGCAGCCAAGACACCCTCACATAGCACTGCCTCCTTCCTCCTCTTTT
CTGTCACCACCTCACCTCCCTCGTCCACTCAACTGAGTGGCTTTTCGCTCCTTTTATACT
GCGCCATGAGTAGTTTTCGTTTCACTGATGTGTCCGAAAAAATTGAGGTTTCATAAAAAA
ATTCGTGGACTTATTTATGGAGAAACAGGGAAATCCGACTACTTAAGAAAAGGGTGTCAA
AGAGGATTTACTTTTTTCCTTCTTTTTGCATTTGTTCCTATTTCCGCAATTGGACGGTTA
TTAAGAAGAACGCAATTGGCTTTTCTGTATATTAAAATACATAGCGTAATAAAAAGATAA
GGTGAACACCAAGCATATAGTATAATATTACCTACCACAT
Chr coordinates Chr XII from 388220-386511
w3c xhtml validator w3c css validator