Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DCN1
Systematic Name YLR128W
Strain S288c
Description Scaffold-type E3 ligase required for cullin neddylation and ubiquitin ligase activation; contains a ubiquitin-binding domain (UBA) for ubiquitin and Nedd8 (Rub1p) interaction and a PONY domain involved in cullin binding and neddylation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DCN1 YLR128W
CATCCTCTGGACAACCGACTAATTTAGAGAACTGAGACCAATATTGATTAATAAATTTGT
TGAATGTTTCCATAATCATAAACCTTTTATTCCATACTCTACTCATGTTATCTTCACAAA
ATTTATTGATTTTGCTGTAAAGAGCATTGACTATCAATTCCGTAGAGGATAAGGAACCAT
TAGCAGATTTGAGCCATTGGATTAAATTGTCTGCCAGGTCGAAATCATCATCCATTATTA
ATTTGTCTAATCTTGTTCTTAAATTATTTTTGAACTTTATATTTCTATTCAACAGATAAT
GTCTTAAAGAATTAAGTTCAAGTGCCCAGTCGTTTACATTTACGTCAAAAATAGGAACGT
AACGTAAAGGAAACTCGTAATAATTTTCCCATCGTTGGATATCTTTTAGATAATTAATGT
TGTTAAAATGTAAGAAAAAATGATAACGAACCTGGAAAATATAAAACTCTTTGAGCGTGG
AAAAAAGTTGTAGTTGTAACTCTTTGTTTGTATTTCCCTCATTAACTATTGAATTGTTTG
CCTGACTAGTGTTTATCATGCTATATGGCGATGTGGTTGCGTTATTAGGGAAGAGAACCT
TAATGATATTCTTAATACGAAGGCTTGGAGGACGTAGTTGATGGTTACTCTTGGCATCAT
TAGGGCTCATCCATGTAAGTAAAGAGTTCAAATCATCGACTATGTTTGTGTGAAAGATGT
ATGAGGAAAGTGTTTGTAACTCATCTGTAATAACTTTCAAATCTCGAGTTGGGGTAATCT
GAAATGACATGATGGAAAAACCTTAACTATAAGCCATAAATATTTACAGTCCCGCTAAGT
CTGGCTTTCGTCTAGTTTTCGATATTTTGGCTCTTTTGTCTATTACTGTTTTTGTAACCA
AAGGTTTGAAAATTTAGATGCAACTAATGAACTTACGCAGTAACATGCAAGTACCCAATA
AAAAAAGAAATTTTTGAAGAGACGTTCTTGCATTCAGGAC
Chr coordinates Chr XII from 398530-398532,398627-399433
w3c xhtml validator w3c css validator