Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TIS11
Systematic Name YLR136C
Alias CTH2
Strain S288c
Description mRNA-binding protein expressed during iron starvation; binds to a sequence element in the 3'-untranslated regions of specific mRNAs to mediate their degradation; involved in iron homeostasis
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TIS11 YLR136C
GAAATGCACCGCTTTCTGGTCAACTGTGATAAGTTTTCCATGATGTTATCTTTTAATTTA
TTAAGAATGCCCTTCTGATCTGTCGACACGTAGGTGTCGACGAAGTTACCAAGAATCACG
GGCAAAATACCTGATATTCCTGCTCCAAGTTCCAAGATACCTCTCTTGCCGCGATCAGCG
CCCGTGAGGTCGACCAGCCTGGGCAACTCAAGCTTGTGCCCCTCGCAAGAAGACCCGCAG
GTTACTTCCACCTGACTCCCAAGACGGAAAGGTGCAGCGCTAGTACTATACAGCAGCCAG
TTGATGAAGAAAGGTGTGGTAGACCACAAAACGTATCCTGTGGTGGAGTTTCCGTTGTCT
CTGGACGAGCGCAAGCTTGATATGGACTGCCCCACGCTAACATGATAGCTATCCACAGCA
ACATTCTGATCTTCTTCAACACTACTAGCCTTATTTCTTCTTCTCACTCGCTTTTTTTTT
CTGCCGCCTTCCAGCCCAGAGGGTTCAAACGTTATCTCTAGCACACCGCCCCTTCTATCC
TGAATACCCAAATCCTGCGCCAGTTTCCCGGACTGGCCCTCCAATTGTGTGTACCGTTCG
AACACGTGCTCGTATATTGTTTCCTCATCCAGTAGCCATAACTTGAATGCCATTCTGCCT
AGCCCATTTGCGTCTTCGCTGCCGTAACCATTCTCTCTTCTTGACAGCACTGCCTTGGTC
AGTTCTCTATATTTGTCGCGCCGCCGCAAAATGCACCCACATTAAAGAAGACGACGCCAA
TCGACACCCTAATTTGGAGGTGTAGATGCACAATGGCACATGCAGTTGGGTGCATTGTGC
CAGCAATCTCGTCTCGATTTCTCTACATGTAACTTGTATATATATTTGAGAGAAGACATA
ATCGTTGGTGGGACTTGGAGGCTCTTGGTAGGTCGTATTTGTGCATCTTGAGAGAAAGCG
AAACAGTGCTGCAAACTCAATACGTAAAAAATAACGCAAT
Chr coordinates Chr XII from 416658-415801
w3c xhtml validator w3c css validator