Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TIS11
Systematic Name YLR136C
Alias CTH2
Strain S288c
Description mRNA-binding protein expressed during iron starvation; binds to a sequence element in the 3'-untranslated regions of specific mRNAs to mediate their degradation; involved in iron homeostasis; protein increases in abundance and relative distribution to the nucleus increases upon DNA replication stress; TIS11 has a paralog, CTH1, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TIS11 YLR136C
GAAATGCACCGCTTTCTGGTCAACTGTGATAAGTTTTCCATGATGTTATCTTTTAATTTA
TTAAGAATGCCCTTCTGATCTGTCGACACGTAGGTGTCGACGAAGTTACCAAGAATCACG
GGCAAAATACCTGATATTCCTGCTCCAAGTTCCAAGATACCTCTCTTGCCGCGATCAGCG
CCCGTGAGGTCGACCAGCCTGGGCAACTCAAGCTTGTGCCCCTCGCAAGAAGACCCGCAG
GTTACTTCCACCTGACTCCCAAGACGGAAAGGTGCAGCGCTAGTACTATACAGCAGCCAG
TTGATGAAGAAAGGTGTGGTAGACCACAAAACGTATCCTGTGGTGGAGTTTCCGTTGTCT
CTGGACGAGCGCAAGCTTGATATGGACTGCCCCACGCTAACATGATAGCTATCCACAGCA
ACATTCTGATCTTCTTCAACACTACTAGCCTTATTTCTTCTTCTCACTCGCTTTTTTTTT
CTGCCGCCTTCCAGCCCAGAGGGTTCAAACGTTATCTCTAGCACACCGCCCCTTCTATCC
TGAATACCCAAATCCTGCGCCAGTTTCCCGGACTGGCCCTCCAATTGTGTGTACCGTTCG
AACACGTGCTCGTATATTGTTTCCTCATCCAGTAGCCATAACTTGAATGCCATTCTGCCT
AGCCCATTTGCGTCTTCGCTGCCGTAACCATTCTCTCTTCTTGACAGCACTGCCTTGGTC
AGTTCTCTATATTTGTCGCGCCGCCGCAAAATGCACCCACATTAAAGAAGACGACGCCAA
TCGACACCCTAATTTGGAGGTGTAGATGCACAATGGCACATGCAGTTGGGTGCATTGTGC
CAGCAATCTCGTCTCGATTTCTCTACATGTAACTTGTATATATATTTGAGAGAAGACATA
ATCGTTGGTGGGACTTGGAGGCTCTTGGTAGGTCGTATTTGTGCATCTTGAGAGAAAGCG
AAACAGTGCTGCAAACTCAATACGTAAAAAATAACGCAAT
Chr coordinates Chr XII from 416658-415801
w3c xhtml validator w3c css validator