Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SLS1
Systematic Name YLR139C
Strain S288c
Description Mitochondrial membrane protein that coordinates expression of mitochondrially-encoded genes; may facilitate delivery of mRNA to membrane-bound translation machinery
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SLS1 YLR139C
ACGTGTAGGTCACGTGATCGGGCTTCTGTGCATAGTGCACGCTCAACTTGCCGGCGAGTT
ACCACCGTCGGTAGCGACTTGTGTCCTCGAGATTCGGCCGCCCTGGCGCTGACGCTGCGG
GAAGCCATACCCGCAAGGGCCGTGCACCACAGCAATGTACGTGTGTAGCGACTTACGCAG
CGCTCCAAAGTCTGCGTCGCGCTGCGCGATAGCGGCAGCGCGTGGCGGGGCAAGGGTCTT
ATCTCCGCGATACGGCTGTGCGAGTAGATGGCCACCCACCTGCGTTTCCAGCTTTCATAA
TCGATAAGGCCCTCGCAGTGTCCTTCCTCATCGGCAACCTCGGCTGCGCCTTCCGTGATG
GCCATCACTGTCTCGCTCAGTTTTGTCTCCAGGGCAACCCACTCAGCGCTCATTTCGTAC
GCAATGGGCGCTCCGTCGTCACCCGCCTTACGCGATCTCGCGCTCGCACTCGCTCTCCTT
AACAACCTGTAATAACCTAGAATCTCCATGGCGCTCTTCCGAGGCAACAATGAGCGCCAC
TCGTCTACACGGTGGATACTATAGCGTGAAAGGCACCAGAAAAAGGTATTCTTCTCCTCG
CTGTCCCAGTCTACACCAACGCTAGAGATTTCTACACCAGCATTGGCGGTACCCGCCTTT
TCATGGATGCTCTTTACATGTACTTTGGAAGGATGGAACTCAGCTGGGCGGCCTGACGCG
GCACCATTGTAGAATTCCTCGACCTCCTTATTGTACAATTCGACGTACTTCCGCAATTGT
TGGTGCTCCATCCTAGGTGACCGTCGTATGCGCTGTGCTTTCCTAGCTCTTCTTCCACTT
CTGTTTCTCTATACTTTTTTTTTTGTTTTTCACCTCGCCCGCCTTTTCTTATTTCAGTGA
ACTGAAAAAAAAAAAAAAAGTTATGTATCTTTAATGTAATAAAACTAGTACATAATATAT
ACGGAGCTTGAAGGCACTGGAGAAAATATAGAGTAAGCAT
Chr coordinates Chr XII from 423473-421542
w3c xhtml validator w3c css validator