Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PUT1
Systematic Name YLR142W
Strain S288c
Description Proline oxidase, nuclear-encoded mitochondrial protein involved in utilization of proline as sole nitrogen source; PUT1 transcription is induced by Put3p in the presence of proline and the absence of a preferred nitrogen source
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PUT1 YLR142W
GAAACGCAGGTGGGTGGCCATCTACTCGCACAGCCGTATCGCGGAGATAAGACCCTTGCC
CCGCCACGCGCTGCCGCTATCGCGCAGCGCGACGCAGACTTTGGAGCGCTGCGTAAGTCG
CTACACACGTACATTGCTGTGGTGCACGGCCCTTGCGGGTATGGCTTCCCGCAGCGTCAG
CGCCAGGGCGGCCGAATCTCGAGGACACAAGTCGCTACCGACGGTGGTAACTCGCCGGCA
AGTTGAGCGTGCACTATGCACAGAAGCCCGATCACGTGACCTACACGTGCTTCCAAGGCG
CATTGTTTTGACACTGCGCAAATGGGAACTAGACTATCCGCGAGAGGGCAAACTGTTCCG
CACCAAGGAGATGGCACATCTGTTTCTACAAAGCCAGTTGTCCAGACGGGATGCGCCCCC
AGTCCATCAAGACGAAAATCAAGAAAATCAAGAAAATCAAGAAAATCAAGAACAAGATAA
CACTGCAAGTGAAGGTGAAAGCGAGGCAGAAAGGGATGAAATCGACGAAGCGGACTTGTT
CCGATCAGCATTACATGAAAATCAGTTGCTAAAATGGTTATCCAAATGAGACACAATGCG
AAAAATCGCGCAGGGACATAATTTTTGTTTTCATTATTCTTTCGCTTATTCCCTCCGTTA
GCTCCACCGCTTTTTTGATTGGAATTTCCTTTCGGCAATGGCTTTCCGGTTACCACGCCT
CGGGTTTCGCATCCCGAAAAGCATATCTACACAAGAAAAATGAATGATAAACAATTGATG
AGTGGCGCTATTTCCCTTATCATCTCATTATTGTACTTAGTATCGTCTATTATCAGGAGA
AATCGCATGAACTAAGCCCATTTTCTCACCCTTCTGCCTTCTTATATAAAGCTTGCTGGG
AACCGAACACAAACTCCACAAGTCCGTAGCAGCTCTTCTCTTTTGTCTTTTATATATCAT
AAACATCGCTACATAGTAATAACACTAACGCACGCTAGAA
Chr coordinates Chr XII from 425186-426616
w3c xhtml validator w3c css validator