Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YLR154C-G
Systematic Name YLR154C-G
Strain S288c
Description Putative protein of unknown function identified by fungal homology comparisons and RT-PCR; this ORF is contained within RDN25-2 and RDN37-2
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YLR154C-G YLR154C-G
CACGGACCAAGGAGTCTAACGTCTATGCGAGTGTTTGGGTGTAAAACCCATACGCGTAAT
GAAAGTGAACGTAGGTTGGGGCCTCGCAAGAGGTGCACAATCGACCGATCCTGATGTCTT
CGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAAGATGGTGAACTATGCCTGA
ATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGGTTCTGACGTGCAAATCG
ATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTG
CCGAAGTTTCCCTCAGGATAGCAGAAGCTCGTATCAGTTTTATGAGGTAAAGCGAATGAT
TAGAGGTTCCGGGGTCGAAATGACCTTGACCTATTCTCAAACTTTAAATATGTAAGAAGT
CCTTGTTACTTAATTGAACGTGGACATTTGAATGAAGAGCTTTTAGTGGGCCATTTTTGG
TAAGCAGAACTGGCGATGCGGGATGAACCGAACGTAGAGTTAAGGTGCCGGAATACACGC
TCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCCGGACGGTGGCCATGGAAGT
CGGAATCCGCTAAGGAGTGTGTAACAACTCACCGGCCGAATGAACTAGCCCTGAAAATGG
ATGGCGCTCAAGCGTGTTACCTATACTCTACCGTCAGGGTTGATATGATGCCCTGACGAG
TAGGCAGGCGTGGAGGTCAGTGACGAAGCCTAGACCGTAAGGTCGGGTCGAACGGCCTCT
AGTGCAGATCTTGGTGGTAGTAGCAAATATTCAAATGAGAACTTTGAAGACTGAAGTGGG
GAAAGGTTCCACGTCAACAGCAGTTGGACGTGGGTTAGTCGATCCTAAGAGATGGGGAAG
CTCCGTTTCAAAGGCCTGATTTTATGCAGGCCACCATCGAAAGGGAATCCGGTTAAGATT
CCGGAACCTGGATATGGATTCTTCACGGTAACGTAACTGA
Chr coordinates Chr XII from 462671-462522
w3c xhtml validator w3c css validator