Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ASP3-1
Systematic Name YLR155C
Alias ASP3
Strain S288c
Description Cell-wall L-asparaginase II involved in asparagine catabolism; expression induced during nitrogen starvation; ORF contains a short non-coding RNA that enhances expression of full-length gene; reference strain S288C has four copies of ASP3
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ASP3-1 YLR155C
GCTACACTTTATACCGATAGAGGAATAACGCATAGAGCCTTCGTAGAATTCTTCAACTCG
TACGTGATGGGGATTCTAAACCTATCGTCATGTCGCTGTACAAGGCTGCTGCCTGCTTTC
AAATTCCCAATTTTACCATGTCCGTTTCGCTGAGCCGAATCGTCACACAAGGTAATTAGT
TCTGGGTATCGCTTCAGTATAGCACTGGTTTTTTCCTTGTAAAACCACAGTCTAACAATT
AAATGAAGCTTTTCGAAGAAATTAGACCATGTTAGACTGAAAGCAAAGACTCCGGCCCGT
TCTGAGGTAAGTTCAATGAAATTGGACAGTTTCTTTTCAAGGTTAGGTTTTGTGTTCGAA
AAAAATAGATTACCGCACCTCCTTTCCAAACCCCATGAGTTTCCATTAAGGAAGAGCAAC
GTCAATAATACCACCTTTTGCAGATGTGATTCAACTCAAGATGCTGTAATCTTTCCCTTC
TGACCCTAGATCACCTCATGATATCCTTTTGAGGCAATTAAAGCTGCAGTGTAAACTGTT
GAATATCTTTTTGAAACCAAAAAAAAGGACGTTCCACACTTGGCTGCTTTCTTGATAAGC
GAGATCTTTACTTGGAGATCTCGCTTAGTCCTCCGAAGGGTAAACCCCGTCTCTTATCTT
TAAAAAAATGTATCAGACCCTTCAGCACGTGACAGACAGCAAACTACCAGTCGACGAGGA
TGCTTTTCCGAAAGTCATGACACAAGGGAAGGACTGTAAGATCGATATCGGCGCAGTCTT
ATCGGATGTTCCAAGTCCTTGTCTCTTTCATTATCTGCTTGCTATCGCAAAAAAAAAAAA
ATCAATTTGTTTAATATCAACACATAATGTACAAGAACAAATCATGACATACAAAAGCCA
TATAAGATGAGTCTTCAAGCAGCACCAAGAGGCCTGAGGCAGAGCAAATGTTGGCTCGCT
ATTCTTTTGTAAGCAATCTGGTACTCACCAACCTCCAACT
Chr coordinates Chr XII from 470405-469317
w3c xhtml validator w3c css validator