Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name UPS2
Systematic Name YLR168C
Alias AIM30, GEP1, MSF1, MSF1'
Strain S288c
Description Mitochondrial intermembrane space protein involved in regulation of mitochondrial cardiolipin and phosphatidylethanolamine levels; null has defects in mitochondrial morphology; similar to Ups1p, Ups3p and to human PRELI
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>UPS2 YLR168C
GCGACGAGTAAAGGTAATGCACACGCTCATGTGTAGTTTCTTTTTTATAATGTATATTGA
ATAGATCCTTTCAGTCGGGTAACAATTCGATCCCAAACGAATCGGGCCCTAACGATATGT
GTAAAAATGGCAATGAATGAACAAGAAGTTATAACAACAATTTCAGCCAAGAACAAGAGC
GATCCTGGAGGAGATTATATACGGATACACAGGTACACAAGATGACGCAATTAAAATATT
TGTTGCTGGTTTCTAGGCAAGGAAAAATCAGATTAAAGAAATGGTACACGGCAATGTCCG
CTGGTGAAAAGGCAAAAATTGTGAAAGACTTGACACCTACGATATTAGCAAGAAAACCCA
AAATGTGTAACATCATCGAGTATAATGACCACAAAGTAGTATACAAGCGATATGCTAGTC
TATATTTTATTGTTGGGATGACGCCCGATGTTGACAATGAACTGCTGACCTTGGAAATTA
TCCATCGGTTTGTCGAAACAATGGACACATATTTCGGCAATGTTTGTGAGCTAGACATTA
TATTTAACTTCAGTAAGGTCTACGATATCTTGAATGAGATGATTATGTGCGATGGCTCCA
TCGCAGAGAGCAGTAGGAAGGAAGTACTGCACCATGTGACCGTGATGGACACCATGGAGA
GCAACGATAATCTTGAAAGGGTATTGAGTTAGGACCACTAAAAAACAATGGAATGAAGAA
GAAAGGAGAAGAATAAGATGAGAAGGGGGCAAGGGGCCCTACTATTATTACCGTCTGTCG
CAAAAGCCGTTGCCCGGACAAAAATATCTTTTGCGAGCATCGGCACAACGTTGATTGGTC
AGAGCGGTAAAAAGGAATGAATGTGAAAAATGTAAAGAATATATAGGCGATAAAATTATC
ATGCGAAGTGATGTACATATTTTTGAATTTAAGCATCAATAGGACGAAAGAATAGATTTC
AGACTAAGATAAAATAATCGAGAATAATTAAAAGACGATA
Chr coordinates Chr XII from 500270-499578
w3c xhtml validator w3c css validator