Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YLR177W
Systematic Name YLR177W
Strain S288c
Description Putative protein of unknown function; phosphorylated by Dbf2p-Mob1p in vitro; some strains contain microsatellite polymophisms at this locus; YLR177W is not an essential gene
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YLR177W YLR177W
CCGTTGCTATTGTCGTTCGAGCCCCGACTAGTAGGTTCAATGTTATTATCACCGGACATG
GGCAAATAAAATTCAAAATAATGAACAGACAAAAAACTAGGCGAGAAGATGAAGTACTTG
GCAGGTATTTTTCTAGTGAAAAGGTTTTCTGTTGGTTTGCGTTCTTTGAAGATTACCATT
TACTGCTATTTTTTTTTTCAACTTTTTCCCAAATCGCCATGACAACACGAAACGACAGGA
GAAAAATTACGAAATCAAAAACAGGTTCAACTGTTGCAGCAATAGACACCACAAACGTGC
GCAAGAAACCGCAACGAAGGGGAGGTGACCGTGCTTGAAATAAAATCCGAAGATCCATAG
GTGAGCCACGAGTTTGATTCCAAACTCGTGGTTTTACCAACGAAGCTGTATATCGTGGAG
TGGCGCTACCATTGGACCTTCGTTTCTTCTTTCCCTCTTCCGCACCGTACCAGATAGGAA
AAACCGCACCTTCGTTTTTGCATACCTAGATGGTCCTGTAACAAGAATAGAGCTAAAGAA
ACAAGTATGCGTCGACTGCTGCCACGCCCGGCTGATTTAGGTGCACATCAGCTACCCAGC
ATACAAAGGGGCTTCCGTACGGTTGATGGTTATTTTTCTTGGTGTGTTGGTGCTGCTGTA
TCGCTGGTGCTGTCTGCGTTATTACGACTATCGTAGGACAAGGCCTCGAGAGGTGTAGGG
TAAATCCCACTTGCACAAAGTATGTACACACTTGATTATCCAAATACCAAGAGAGTGTGG
TTCAATTTACGGGCAGCTCGAGCTGCCCGTAAATTGAACCTTCCCCTTCCCCACGCTCAA
GGGGTTCCTGCGCCGGTGTTTCAGGGGCAGGACACGCGGGGATCGCTGGCACAGTATATA
AACAATAAAAGAACAATGGAGAGAGGAGGCGCCATTCAATATCAGCTCACTAGAGTGCAT
AGACGTATAGACACAGGAATAAAGATAGAAATAGGGTACC
Chr coordinates Chr XII from 511054-512940
w3c xhtml validator w3c css validator