Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SAM1
Systematic Name YLR180W
Alias ETH10
Strain S288c
Description S-adenosylmethionine synthetase; catalyzes transfer of the adenosyl group of ATP to the sulfur atom of methionine; SAM1 has a paralog, SAM2, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SAM1 YLR180W
GACGAATCCGCTCCCTTGGGTTGCTTGCACAGGAAGAACACGTATCTGTGATAACCGGAG
TTCTTTGGTGGACCAGGCCCAATATAGTTATTTCTCACGACACCCTTCCCCGAAATGGCA
ATATCTCCCCCAGGTCCGTACTCGACAGGAATATCAGTGATGATGTAGTGACAAACCTCC
GACCACTTATGTTCTGTTCTAGAGGGCGCGTCCGGGTCAGTCATCAACAAAGCGAGTTTA
TCCTCGGCTGACAATTGGCTTTTATCGAAGGGCGTGAACTTGATGGTAGGAGCGGCTTGC
GTAGCTTCCATTGGCATGGGATTGCCCAATTTGATGTCGTCAGAATCAACGTACGAAACC
GACAACTCACCAAGAATCTCGAACGCCAAGTCCTTGACGGTGTCCTTAATGATGTCCTCT
TTGTTCAGTTTAGCAACGATGGCACTAGACATAATATATATTTCTATTACTAAGTACTCG
GATGGGTACCGAAAGTGGCAGATGGGCAGTGTTTACTCAAACAATTGATGGCAACATTCA
ATTCCTCACCTGGTGCGCACTTCCAATAATGAGCACGCTTGGCACTTTTATATTGTTCAA
AAAAATGTCAGGCAAGATCTTTTGAAAAAAAGGTACCGAAACGGACGTAAGACGGAAATA
GAATTTGAAGATAAAGTTATATATCACTACACACGAATACTTTCTTTTTTTTTTTTCACA
GGAAAACTGTGGTGGCGCCCTTGCCTACTAGTGCATTTCTTTTTTCGGGTTCTTGTCTCG
AGGAAATTTTAGCCTCATCGTAGTTTTTCACTCTGGTATCGATGAAAAAGGGAAGAGTAA
AAAGTTTTCCGTTTAGTACTTAATGGGATTGGTTTGGGACGTATATATCGACTGGTGTTG
TCTGTTATTCATCGTTGTTTTTCGGTTAGCTTCGAAAAAAAAATAGAGTAAAAACCAGGA
ATTTACCCTAAAAACAAGAAAAAATAAGATAAACGAAAAT
Chr coordinates Chr XII from 515262-516410
w3c xhtml validator w3c css validator