Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TOS4
Systematic Name YLR183C
Strain S288c
Description Forkhead Associated domain containing protein and putative transcription factor found associated with chromatin; target of SBF transcription factor; expression is periodic and peaks in G1; similar to PLM2
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TOS4 YLR183C
TCAAATTGTTGTGCAATTTGGTTAAGTTTGTTAGTACAATTTGCTTTATCTTATAGTTAC
ACTTTTTTCGTGACTGTTACAACGCCATTGAAATTGATCCTTTCGAGTTCCCTCAGGCAT
ACAAGCAGAATATTTCTTCTATACGGTAAATTTGTTGTCATGCGCATGTCTTTCGTTCAC
TATTCTGTCTTCATACAAGTATACCAGTCTCGTATCGTCCAGTCTTGCTAAGTATAAATT
TGGTGTGCATGCGTTCCGATATTTCTCTTCAGATAATCATAACATTTCTCCACGGTCGTC
AATAACAGGTTCACAGTTTTATTCTCAATGTCCTACTACATACTACCCATTTTTGTCTAT
ATTATTTGTATGAGGCTTTAGCAAATACCTCTTAAAAGTAAACATTTTTGAAATTTAATA
GTACCCTCATATAGAGCATTTCTCATTCTTACACTTGTAATATTGACGGTGATGAGAAAG
CTACCAGGAGAACATCAACGTTTGGAGGAGACAGACCGACGGACCACACTTCACCAGTAT
GGCATCGCCCTGCCTACCATCAGCCTAGAGAACGGGCAGACGGATTGACTTCCCTTTCCC
CAAGGGGCCGCCTTCTTGTTGCCGGCCTGCCGAAGTGTGTTTTAGAATTTCTTCGAAAGA
GAATAGTCTCGACAACGTTTTGTCTTGGAAAACCTTTTGTGTACGGATGTTTAGTTAATA
ATAATGTACAGATGTTAATATGGTTTTTTTTTTTTGATATGAAAACGCCAAAACGCGAAA
AAAAAATCCCGTGGCCCTTTTTTCTTAAGTTCATCTCTATGGTTTGCTTTCGTGTTTTGA
TGAGAATGAACAGCGGCAGTCGACGTAAACTAAAATTCATCAATGGAAACTCTTTCTCTA
CTTTCATTCATTTAGAATTGAATTATAGCAATCTACTTTACGTACAAAAGTCCATATACA
TCTGCCACGACACATCAAAGATTAATAATCACAAGAAGGC
Chr coordinates Chr XII from 522012-520543
w3c xhtml validator w3c css validator