Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name NCW2
Systematic Name YLR194C
Strain S288c
Description Structural constituent of the cell wall; attached to the plasma membrane by a GPI-anchor; expression is upregulated in response to cell wall stress; null mutant is sensitive to the antifungal agent polyhexamethylene biguanide, resistant to zymolyase treatment and has increased chitin deposition
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>NCW2 YLR194C
GGATATGATTGCTGAGAATGCGTTACCGGCCAAAACAAAGACAGCGGGATTGAGAAAATT
AAAGAAGGAAGATATTGACCAAGTTTTTGAGTTGTTCAAAAGATATCAATCCAGGTTCGA
ACTAATTCAAATTTTCACAAAAGAAGAATTCGAACATAATTTCATTGGTGAAGAATCGTT
ACCATTGGATAAACAAGTAATTTTCTCATATGTAGTCGAACAGCCCGATGGAAAAATTAC
AGACTTCTTCTCATTTTACTCATTGCCATTCACAATCCTAAATAACACAAAATATAAGGA
CCTAGGCATCGGGTACTTGTATTATTATGCCACCGATGCAGATTTCCAATTCAAAGACAG
GTTTGATCCAAAAGCTACTAAGGCTTTGAAAACAAGATTGTGTGAATTGATTTATGACGC
TTGTATTTTGGCCAAAAACGCTAATATGGATGTTTTTAACGCGTTGACTTCGCAAGATAA
TACATTGTTCTTGGATGATTTGAAGTTCGGGCCCGGTGACGGGTTCTTGAACTTCTATTT
ATTTAATTATAGAGCAAAGCCGATTACCGGTGGCTTGAATCCCGACAATAGTAACGACAT
TAAAAGGCGTAGCAATGTCGGTGTTGTTATGTTGTAGTGGCTGAAAGGACGAGGCGTATA
TAGTTTTCGTGTACATAGCCGACAGAATTTGACCACATTTAGTTTTTCCGCATAGTCAAT
TGACGAAGTGAAAAAATAATTAATCCAATGGCTGGCTTTAGAGTGTCAGCCTCCAAAATA
AATCCAAAAATAGACAAAGAGAATCACTATAATTACCGCCTTGGAGTCCAAGTTGGCTTG
AGAACTCGCATTTATTTTTAGCGACTGAGGTAGCTGAAAAACGCCTACTTTCTCAGAAGG
CGGTAGTGAGCATATATAAGTATGTAAGAAAGATCAACTCTTCTGGACTAGATACTCACC
GATCTAGTGAAAATATAAACAAACCCAACATATATATAAA
Chr coordinates Chr XII from 541573-540809
w3c xhtml validator w3c css validator