Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PWP1
Systematic Name YLR196W
Strain S288c
Description Protein with WD-40 repeats involved in rRNA processing; associates with trans-acting ribosome biogenesis factors; similar to beta-transducin superfamily
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PWP1 YLR196W
ATCTGAAGCCTGCATCGCGGTCTTCCACGTAGTTTTCATTTAGTAGAACGAAAACATCTT
CAAGCTGTTTTTTGTTGTCCACATCAATACTACACCATTCGAAGCTAGACAATAAAGGTA
GTGGCTTGTCAGATATATCTTCCGGTGTCTTTGGCTTATCAATGGGGCCTTCTTCCACCA
CCTTTTCATCGAAATCTTTGACCGGTTGCGTTCTCCAGAATTTGTGGTCTTTCATAGCTT
TTTTCTGTTCTTGAGTGAATTTTGAAGTATCGTCATTATTCAACTGTAATAACTTCAATA
AATTCTCTAATTTTTTCGCTTTATCCTCTTCTGACATTCTATAAATACGTTTACTACCGA
AGCTCTATGACAACCAGAGCTATTGTACAGATCATTCTCTAAAAAGCGTGCAACACATAT
CATCTTCAATTATAGTGAATTACTTTTATCATGAGCAACGGCTGAAATTATTTTATCCTA
TTGTTTTATGACAGTATCCTTTCAAAAGAGTCGAAAGGATCCTCTGTTGCAAGAACTACT
ATTACGTAATTATACATAGTCCGCCTGCAATTTCTAGTGAGACTTTGCTTTGCTTTCCAC
TTTGCGATTAATATTGAGAATTTTAAACGTTAACTGAATTCTTACCCACCCATAATAAGA
ACTCTAACTGGCGAATTTATCATGAAACAAATCTGCAAGAATAAAAAATTAGAGAATCGT
GCAATTCAATTTAATTGCCTTGTCCGTTGTAAAACTTTTCCATAGGCCCTACCTTGAGTT
GATCATATGTATTATTCTATATATATTATATCCAGTCGGGTAATAAATTTTCTCGCCCTC
GAAAAAAAGAAGTGAAAAATTTGTCTCGATGAGCTGAGATGAGTTTGAAAGAAGCAAAGA
GTTTTAATTTGTAAACGATAGCAAGTGTACCCTCAGTTGAGTCTATTACGCCTTCCTTAT
TTGGAAACTTAGAAGACGAATAAAAAAAACAAAATAACTA
Chr coordinates Chr XII from 543968-545698
w3c xhtml validator w3c css validator