Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name COQ9
Systematic Name YLR201C
Alias FMP53
Strain S288c
Description Protein required for ubiquinone (coenzyme Q) biosynthesis and respiratory growth; localizes to the matrix face of the mitochondrial inner membrane in a large complex with ubiquinone biosynthetic enzymes
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>COQ9 YLR201C
ATACTTTATATCCGTTGGAGAATAGATCTTTACCAACCACAACTAAGAACCGTGCTATGA
GAATTTTCATCCTAGGTGCACGTGCTGAAGCTCAATTGCCGGGCCACGTTTGGAAACAGC
TCCAGTTTCTTTTCCCAGAGCAGAGTTTCGAAATACATTTCATTGGACCCGAATGCCTGT
ATAAAAGGGATAAACAGGAGTACGTCAAGTCTACTACGCCGGTAGTACAAAGAGTAGACG
AGACTCTGAAATTCATTTATCGTACAAACTTTTTCGAAGTATTCCATGAGGCTCAAGATT
TTTTCCCATACGATCCATACATGGATGTCTTTTTTACTTTCCATCCAGGCTACGCATCTC
CAGAATCTCACGGTTCATGGATGGGTGAAACTATGAAGGCATTACTGGAAACAAAATGTG
CTATCTTCACAACGGGTTTCAATAAGAAAGACCTAACGGACGACATAAATCTTGTCAAAT
CCAAATACGGTAAGGAAATGGATGTCTTAATGGAGCCCGTCAGAAACGTATTTGGAAGTA
CGAAGTGGGAATTAAATGACATGAATCCTCAAGAAGTTTATCAATTTAACATGTATATTG
CCGGGTTCAGAGGTAAAAGGTACCATACAATCAAGAGACAATGATTATCGGGAGGCCATG
CCCAACTTTCATCTTATAAATATATGCGTTTTCTACCGTTATTATAATTTTTTTCTTATG
TATGATATCTCAATATCTGTAAATACAAAAATACTAACCCCACCCCCTTCGTAATGGTTG
ACCTAATAGTCCATTAACTAATCCATTCACCTATACAGTAGTATACTGACTACAGTTGCC
ATGACATATCCTTTCCTTTTCGGACTATATTAGGCGGAAGAAAAATAGCAATAACAATAG
TAAGAAACAATAATACGGGGTTTTTTTTTTTTTGGGCCTACATAAGGTACTTCACCCCAA
TTTGGAAAGAGATAACAGAGTCTTTACCACATTATAAATC
Chr coordinates Chr XII from 550293-549511
w3c xhtml validator w3c css validator