Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HMX1
Systematic Name YLR205C
Strain S288c
Description ER localized heme oxygenase, involved in heme degradation during iron starvation and in the oxidative stress response; expression is regulated by AFT1 and oxidative stress; relocates to the perinuclear region in the presence of oxidants
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HMX1 YLR205C
GAGTCCTCGAGTCGTTCGCCGTGGCATCTCTCACAAGCACTTGTGTGGATGAGTAGCCCT
TCATCATGTTCTTTGCAGAACGAACAAACTGCTTAGACATTACTTACAAAACAAATACAC
TTAATAGGGGTGTGTCAAAATAAACAAAAGAAGATGATAAGAATTTGTGAAGGTCAAACT
AGAATGTGAGCGTATTCGCAGTTGTAGGCAAAACAGAACAAAATAATTAAATAAACGAAC
GCCTCCTTCAACAAAGGTCAATAATGTAGCAAAATATTGGGAGTGTGTCAATCCTTGAAA
GGGTCCGTAACTAAACTCTTCTTTCTTTAGTTTCCACTACTTTTTTTTTCACCCTTCGCC
GCAGGGTAATTTCTTGTAGGCCATGTATATACGATTAATCGTTACACATAAAATGCGGTT
TGGACAAACAATACAATGGATCGTGCGGGATACTGCCAGACTACGCTATGCTCGACTGTA
GAATACTGAGTGGTGATATCGCCCCTTCGGTATTGTGATCTTGGGCGCACTTGTTTATCT
AACAGGTGCGGGTGCAAGTTTACTAGAGCATCGTCGTATGATGGGGAAAGTCAGGGTGTA
TGTGCCCGTCGATTGAGCACCAAGACCCGTTGCCATGTGCATATGTTATTGTACCCATAG
AGGCAGTCCACGTTCGGCCATCTATCTATCTTTAGATAAACGGATCATTGGCGATACCGC
CTGGCCATTTGCACCTGCTCGGGGTCGGCGTTATCGGACCGTGGAATTTGAGCCATGTAA
CACACGGTTTCAAACATGGGCTAATGACCTTCATAAGTAGGACGATTTACACCTGAGTTG
GGTGTGATGGAGCAATGGCCAGGTGCCCCTCTCGCCCTCTTGTGTTTGTATATAAGAGCA
ACCTCCTCATACTCTCTTGCTTAGTCTAAGGAGGAGCTATTTAACAGTGCACAATATAAC
ACAGCATATATACACACACACACATAAAATAACCGCAAAA
Chr coordinates Chr XII from 553677-552724
w3c xhtml validator w3c css validator