Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FRE1
Systematic Name YLR214W
Strain S288c
Description Ferric reductase and cupric reductase, reduces siderophore-bound iron and oxidized copper prior to uptake by transporters; expression induced by low copper and iron levels
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FRE1 YLR214W
ACACCCACCTTGGTATTTGCCTTATTCGGTCCATTTCCCTCTCTTATTGGTGGCTTAGGT
TGATAGTTCACAATAAATTTAGGAACCTTTGGTGTGCTAACAAATTCAAGTTTTTGACTG
GCGACTAATGCAGGTATAGGAGCACAGCTTTCCTCGTCGAAAGATGACCTCACGTTGCAG
CCACCGACACATATCGGTCCAGCGCCACATTCATTATACGGCGAGCAGCACGGCCATTCT
GCGGGACAAGGGTTATTTGGAGAACAAGAAATGGAGTTTTTGGGTTTGTATAATTCTCCC
AGTGCAAATCCGATGTAGCCAACAACCGGCACCAGCTGTAATATTGATATTCTCATATTT
TTATTTCGTGCAAAAGCCCTTGATGATACTCTAAACTAAACGACTGTTCTTGTATTTCGT
TATTAATCGATAATTATTAGCTGGTATTGTCTTTTTTTTTTTTTTCCTACATGATCGTCG
CGAGGCTTTACATAATTTTTGTGACGCCTTTAAAAGTATAGTAGAACGAGCACATAAGAA
GTAAATGAAAAGTACGGCAGATGCAATTGACAGTAAAGAGCGGTACAATAGTTGAAGAAT
ACCCGATAAAAATGTATTTAGGTTGCTTGACGGGTTTGCAGCAATTGCCAAGAACACTAA
CTGTGGCAATCTTGGTGAGAATCTACTCCCAACCCAAACATTTTCGCCGATATTTTTGCT
CACCTTTTTTTTTTGCTCATCGAAAATTGTTATAGCGGCTCGACTTTGATTTACTAATAC
ACCCAATTTCTAATATCCTCAAGGCTAGATCGTTCTCTCAAGGAACTTAAAGTGCCTGAT
CTTGCGATGATTAATCTACAGCGATGGATACTTAAATCATGTAAAAATCTCAGTTTTGAA
GTCGTTTGCTCTCTTCCATGCTTCAGTTCCCTTTTGGAAGGTAATATAATCATCTAATTT
CTCGCATATTCACGCCGACGGAAGAACGAGCCGGATCAAT
Chr coordinates Chr XII from 568567-570627
w3c xhtml validator w3c css validator