Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CPR6
Systematic Name YLR216C
Alias CYP40
Strain S288c
Description Peptidyl-prolyl cis-trans isomerase (cyclophilin), catalyzes the cis-trans isomerization of peptide bonds N-terminal to proline residues; binds to Hsp82p and contributes to chaperone activity
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CPR6 YLR216C
AGTAATCATACCTAGATAAATCAGGTACCCTCCTGTCCCTCTTTGTAAAACCAAATACCA
TTTTCAACTTTCTTGATCAACAGAATGTCTTTGTTTGTTTATTCTAGTGAAAAAATAGAA
GTAAAAAGCAATCAATATAAGCAACGTGAAACGATCGAAGGAAACTAAAAGAGGTTTGAT
GTTAGAAGAATTGATTAACACCAAATCAAGCAATTTATTGAAGTATGGGTCCCTGATGTT
TGTCCTTCTCGTTCTTGCTTTCCCTCCCCTCTTCTCATCCATTCGCTTCATTTATGCTTT
TATTTTCTTCTTTTTTTTCTCACAACAAATGTCCGAAACAAAAAAAGGGGCCTCAGCCAT
TAAAGGTAGTGAAAGGCACTTCTAAGAGTTGCGCCAAACAAGGGAAGATTAAAGGGAAAG
AAAAGCTCTGGCAGGCTAAAACTGGCAGACTGGTCATGAGTGAAACTGGCGAAACTTCAG
AGTATTATAAGCAGGCGCTGGAAGAATACAAAGAGGTCCAAGAAGACGAAGACCCGGATG
TGTGGGACACGAGAATATCCAAGACCGGATGCTACGTAGAGAACCTCGCATTACAGCTGT
GCCATGCCGAAACAGGTGACTGGAGGCAGTGCTTCAACGAGATGGCGTTATTTAGGAAGT
GTTGGGAAAAGAATGGTAATAGAGAGCGCGTAAGCACAGTGGACGTGGATGGGACGACCA
GTAAGGATTCGGAAAAGAAGAAATGAAAATCTAAATGTCGTGATGTATAACTTGTATATA
ATAGACAGCTGCAGTGATCGAAACACATTGTTTCCCTTTATAGAACATAACTGTTACGCT
TTTGAACGGCATTTCTATGAGCTTCTAGAATATTTTTCCGCCCTAGCTGGAGAAAGTTCA
GACAGAAAATTATTTAAATAAGTCGAATATCAGAGGTGCTGATGCGCTCACATCACATAG
AAAACTGGTAAGACAATATTCAGGCGATCAAGGAGTAAAA
Chr coordinates Chr XII from 573211-572096
w3c xhtml validator w3c css validator