Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YLR257W
Systematic Name YLR257W
Strain S288c
Description Protein of unknown function; protein abundance increases in response to DNA replication stress
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YLR257W YLR257W
ACACAGAACAAGAATCCATAAAATCAAGATATTGGGAACAATTCATTGTCTTAGGAACAA
GTTTTTATAATTTAGTTTCATTAGCCTATTGTAACTTCTTGTTTTTTTTTTTTATTTTGG
CTGGCAAAACAAGAAGTATAAAGAAGTTACCACTGCTATAACGTATATCTTAAATCAAGT
GGGCAATTCTTCGAATAAACTTAGAGGCGCTGAAGAAAGAACCGCTCAATTAGTTCGATC
ATACAAAATACAGATATTGCGCTGTGTATTATCATTACGGAAAGTGTGATATAAACAATG
CTGTGTTGTATTCGGTCTTTTTTTTCCGCCTGGAGATTGTCGTTTTTGTTTTTTTTTCTC
GTGTAGCTGCAGTTATCATCGTTTTGCATGTCTGTTCTGTCGGTGAAGCCGATCTCATGG
CACTTCGCTTTGATACCGTAAAGAATCTTCTTCATTAATACGGCACTGCAAGGCGATATC
TATCTCTGGGGTTAGGACTGATAAATAGGTACTTATCAGTTATCACTAGAGACGAACTGT
TTACGTTTTGAAGCTCGACAGCAGGGGTTCTTAACGGGCGTCGGCCTAGACCTCACCTTG
CGAGAAATTTTTAGTTCATATCCAGGGGATGGTGAATGGTTGGATCTGACGAAGCCACGG
TAAGGGCAAGGCTTTGCGCATGCACTGGCCACTATGCATACCATATATAAATAGATAATC
AAGCGTATAGAAAACGACATGCTAAGTTATTTTACTCAGTGTTAGGTCTCTTAGTATTTG
CGTCTGAAAAGATCTTAGCTCTGTCTTTGACTCTATCACTTATTTTTAAGAGGTTCTCTA
TTCGTCAGTGATAGAAATAGCATTTTGACCCGCACGACATTGGTTAATAAGAGTACTTTT
CCACGTGTTTCGATTGCCTTTATTTTTAGCATACTTGAAAATAATATTATCGTGAGATTT
AGGTAAAATATACCACATATCAAGAGAAAGAGAAGTAAGA
Chr coordinates Chr XII from 658826-659791
w3c xhtml validator w3c css validator