Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GSY2
Systematic Name YLR258W
Strain S288c
Description Glycogen synthase; expression induced by glucose limitation, nitrogen starvation, heat shock, and stationary phase; activity regulated by cAMP-dependent, Snf1p and Pho85p kinases as well as by the Gac1p-Glc7p phosphatase; GSY2 has a paralog, GSY1, that arose from the whole genome duplication; relocalizes from cytoplasm to plasma membrane upon DNA replication stress
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GSY2 YLR258W
TTTGATGGAAGACGAGGGTAATGAAGAATACACCAAAGATTTGGAAGAAGCAGCTAACAA
AGCTCAACCACAGTAGAATGGAATATTGAAACTGGAGTGACTTCTGATGAAGTTTCCAAT
TATTTATATGTATACATTATTTATTTGTCTATCATTAAAATTTCTGTCAAGTAATGGCTT
TTTATGTTTATTTCATGGATTACGAAATTTGCTGGCTTTTTAGAGTGACCGATGAGTTGC
ATGTACATATGTGCGAAATAAAACAATACGGTAGTAAAACATGAATACTTCGAGAAGTAA
ATTCAAGATTGCAGGCGTAGCACAAGAATGTCCTTCCGCCTGCTAGTGTGTTGAGCAAAG
CACGCCATCACTAATGGAACCCTTACAAAATCTCGCATGGAGCAGCAAACCTTAAATCCA
TTTTCTATCATTCGTTCCTGAGGACCCGGATATCGTTTTAGAGACAAAAATAGATACTAC
AAGAGGAATAGGGATATCTGCACATGGGGCCTCGAGCATGGCTCATTTTCGATTTTCCGG
CACGATGCTGACTTAGTACTATCATGCCAGGCAGGACAGGCCTTATGGGGTTCTTGCAGC
TTACCAATTCTGACACTGGACTGCCCCTGGATTAGCGACCCCGCGACCCCGCGACCAGAC
TCCCTGAAAATGGTAATTGGTGATGATATATGTGACTGAGTTCAGCCTGGGCATACAATG
TTTAACCCTTTTGGACATGGAATTAGGCCAGCAAAGGGAGCAGCTTTCCCCGAAAGCGTA
GTTTTTCTCCAGGAACGCAATTCACCCCTTTCTTTCTTATGCAAGCTCCTCGTACATATA
TAAAAATATATGAGTATATATAGTGCTTCTACAGCATAATCAATTTAAGGTTCCTTGCCT
TTCCTTAAATATGTTAGCTATCTCTAAAGCATCACTGAGAAGTGGTAGTTTTTTTGATAA
CTGTGATTGAAGTTTTGACTACCTCAGAGAAAAATTTTGA
Chr coordinates Chr XII from 660716-662833
w3c xhtml validator w3c css validator