Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name LCB5
Systematic Name YLR260W
Strain S288c
Description Minor sphingoid long-chain base kinase, paralog of Lcb4p responsible for few percent of the total activity, possibly involved in synthesis of long-chain base phosphates, which function as signaling molecules
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>LCB5 YLR260W
ACCCAAAGTAGCAGCAACCGCTTCAGCTAAAGTTTCGACACCCTTAAGAAGGGAGGCTCT
TCCTTCTACACCGAATTTCAATTCTTTATGAGAGGAGTAAGCACGACGCAATAAAGGCCT
TAAAGTAGCGCGACTACGAACAACGGATGATCTCAACATTTTGAAAACTTTTTTGCTTAT
GATGTTTTCTCGTGGGAATTTTCTTATATTATTCAAGGAAGTGCATGAAGACGCAACCAC
GACCTTACATAATGAATGTAAAACTTAGTCTCCTTCAATATATATACATGAATGTCCGTC
TGGATTCTGCTCCGGGCAAAACGAAGCAAAATTAAAGTCACCCTCCCCATTTGGTTTTCT
GGAAAATTCCACGAGGTCCGTATATGATGACATATACAGATGGGCGGCTATAAAGTAAGT
TTCCAGAGGTAATACCAGGCAATAAACAGCTTCAATTGCTCGTAACACCATTGTATACCT
ACAAAAACAGTGGAATAGGGATGAGACATAACTGGCTGGAATTTCAACTGTACTTCTTTG
CACAACTAGTCTTGGCGTTCTACTTGATCATTGCGCGAATGGATGCACTCGCAATAATTC
CCAATAGTATAACAGGAGGAACATTTGGATGCATTAGGTATATTATTCATCTTCTTTATC
ATCAAAATTTTCTCTTCCTTTATGTTACTATGTTGCTTTCTTTTAATCTATGTTTTTTTC
CCTTTCAGTTGCCACCGCTTTTCTGCAAGATTCATAGTTAGATTTGCAAATCAAGGTGTT
TTCGGGCCTTGTTAAAGCCTTCGCAGGCGAAGAAGAAAGGGAACGTAAGCTGCGTGAGCC
GAATCTATTTATACAAAAACAATCAAAAAAGTATAACTACAGCATAAACTGTTGTATATA
CGTGTTGCAAAATAGGAAAGAAAAGAAGAGTAAAAGGACTCTTGATATTATCTCGAAAAA
ACCACAAATAGTGTAAGATTTAAACAGTAAGCCAAAAGAG
Chr coordinates Chr XII from 665844-667907
w3c xhtml validator w3c css validator