Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YLR285C-A
Systematic Name YLR285C-A
Strain S288c
Description Putative protein of unknown function; identified by fungal homology and RT-PCR
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YLR285C-A YLR285C-A
GAATCAACTATTGCAGATATTGCCTCTTCAAGTTCTTTTGGTGGTATTGCGTTATGGGAT
GCATCTCAAGCCTTTTCCAACGAGCTAAATGGTGAACCATATGTTGAGATTTTGAAGAAT
TTGCTAACAAGTGCTAGCCAGACCGCCACTACTACAGTTGCCACCTCAAAAACCTCAGCA
GCCTCAACTTCATCTGCTTCAACTTCATCTGCTTCAACTTCTCAGAAAAAGACCACACAA
TCTACGACATCTACACAAAGTAAAAGCAAAGTTACTTTATCTCCAACTGCAAGCAGCGCT
ATCAAAACATCAATTACTCAAACTACAAAAACATTGACGAGTAGCACCAAGACAAAATCT
AGTCTAGGTACCACCACAACAGAGAGCACTTTAAATTCAGTTGCTATCACAAGTATGAAA
ACTACTCTATCTTCCCAAATAACCAGTGCTGCCTTGGTGACCCCTCAAACAACTACTACT
AGCATAGTTTCTTCGGCCCCAATTCAAACAGCTATCACTAGTACTCTTTCGCCAGCAACG
AAGAGTTCTTCTGTCGTTTCCCTACAGACAGCTACTACTAGTACGCTTTCCCCAACAACG
ACCAGTACAAGCTCAGGTAGTACAAGCTCAGGTAGTACAAGCTCAGACAGTACAGCTCGT
ACATTGGCTAAAGAATTGAATGCTCAATATGCGGCTGGTAAATTGAACGGTAAATCTACC
TGTACTGAAGGTGAAATTGCATGCTCTGCTGATGGGAAGTTCGCCGTTTGTGATCATAGC
GCTTGGGTTTACATGGAATGTGCTTCTGGAACCACATGTTATGCTTATGACTCCGGCGAC
TCAGTCTATACCCAATGTAATTTCTCTTATTTGGAAAGCAATTACTTTTAAAGTTATTAG
AGATTGATTCATAGAGTCCGAATATTTTTTTTTGCAATATTCTTTATTTTTCACCTCATC
TCACCGCCTCTCTTTTATTTCGTCAAGGTACCCTGCCTTC
Chr coordinates Chr XII from 708338-708168
w3c xhtml validator w3c css validator