Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CTS1
Systematic Name YLR286C
Alias SCW2
Strain S288c
Description Endochitinase, required for cell separation after mitosis; transcriptional activation during the G1 phase of the cell cycle is mediated by transcription factor Ace2p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CTS1 YLR286C
CCAATGAGGAGGTAAAAGAAGAACAGGCTGCATTAGTTGCAGTAACTAAAAAAGTTCTTA
TCCAAATGAGTAAACTATATGAAGGTGATCCAAAAAGAAAGAAATGGATTGACACATGGG
AGATAAAATTCAATGAATTGTTTTAGTATATTTTCTCTGAATGTTACAGTGCATGGTATA
TAATCAGTCTTGTTTAGAAATTCATGCTAAAACGGATACAAGAGATATCATTGTGTAGCT
GCGAGATCCACGGTCACGGCAAAAACCATGTCCATTAATATAGTGGTTGGTTGGTGGGAA
TATGTGGGATATCCTCAACAAAATCGAACTTATATACGTCATTCTCGTTAACAAATTCAA
ATTTTGTAGTTGTCATAGTAACGCAAAATGAGATGCGTGGGTGTGATTCCTGCTTGTTGG
TATTTTTCTTTGCCGCTGGTGAAAAATTGGAAATGCTGGTCCCTTGAAAAAATAACCAGC
CTCGCCTTAACAGATATGTGCGAGTAAATATGAGTTTCTAACGTGCAATGTTTGGTGTTT
GTTTATTTGTTTATGTGTTTCAGATGTTGAGTAAACATTAGCATTGGTGTAAGAACTAAG
CCCCTCGATGGTTCGGTGCAGGATTCAAGGAACAAAAAAAAACTAATATGGACGGAAGTA
TTTGGCTTCATAGGCATTGGTCAAAGATATAAAAAGATGCAGGTATTAGGTCCTTGGATG
GAGGAAAAACGTCTCACTTACCTTTCCTTGTATAATTTATAGAATGGACAACAACAATAC
ATTACATTAAGATTATATCAGTCAAGTTTTTTCATAACATTGAAGATCTTTCACTCATTT
AAGACTCAATAACATAAAAAAAATAAACCTGTCATTCCTTTGAACCTTTTTATATCCAAA
AATAATAACTGTCGCTCGTTTCACAACCTACCTTTTTTAAAACCACTCTTTTTCCAATAC
ATTGAAATTCTAATTTAAATATAAAATAATTAATAATAGA
Chr coordinates Chr XII from 710136-708448
w3c xhtml validator w3c css validator