Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CTS1
Systematic Name YLR286C
Alias SCW2
Strain S288c
Description Endochitinase, required for cell separation after mitosis; transcriptional activation during the G1 phase of the cell cycle is mediated by transcription factor Ace2p
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>CTS1 YLR286C
ATGTCACTCCTTTACATCATTCTTCTATTCACACAATTCTTACTACTGCCAACCGATGCC
TTTGATAGGTCTGCTAACACAAATATTGCTGTTTATTGGGGTCAAAACTCAGCAGGAACG
CAAGAATCCTTAGCTACTTACTGTGAATCTTCTGATGCTGATATTTTCCTATTATCTTTC
TTGAACCAATTTCCAACCCTTGGTTTGAACTTTGCCAACGCATGCTCTGATACTTTTTCT
GATGGCTTACTTCACTGCACCCAGATTGCTGAAGATATTGAAACTTGCCAGTCCCTAGGA
AAGAAAGTTCTATTATCATTAGGTGGTGCATCTGGTAGCTACCTCTTTTCAGATGATTCT
CAAGCGGAAACTTTTGCACAAACTTTATGGGATACTTTCGGTGAAGGTACAGGTGCCAGT
GAGAGACCATTTGACTCAGCAGTCGTTGATGGTTTTGATTTTGATATTGAAAACAACAAC
GAAGTAGGCTATAGTGCGTTAGCTACCAAGTTAAGAACTTTGTTTGCCGAAGGTACAAAG
CAATATTACCTTTCTGCCGCACCACAATGTCCATACCCGGATGCTTCTGTTGGTGACTTG
TTGGAAAATGCAGACATTGATTTTGCGTTCATCCAATTTTACAATAATTACTGCAGTGTG
AGTGGTCAATTCAATTGGGATACTTGGTTAACCTATGCTCAAACTGTATCCCCAAATAAA
AATATCAAACTGTTCTTAGGTTTACCTGGTTCTGCTTCTGCTGCTGGCTCTGGTTATATT
TCTGACACTTCTTTATTGGAATCAACTATTGCAGATATTGCCTCTTCAAGTTCTTTTGGT
GGTATTGCGTTATGGGATGCATCTCAAGCCTTTTCCAACGAGCTAAATGGTGAACCATAT
GTTGAGATTTTGAAGAATTTGCTAACAAGTGCTAGCCAGACCGCCACTACTACAGTTGCC
ACCTCAAAAACCTCAGCAGCCTCAACTTCATCTGCTTCAACTTCATCTGCTTCAACTTCT
CAGAAAAAGACCACACAATCTACGACATCTACACAAAGTAAAAGCAAAGTTACTTTATCT
CCAACTGCAAGCAGCGCTATCAAAACATCAATTACTCAAACTACAAAAACATTGACGAGT
AGCACCAAGACAAAATCTAGTCTAGGTACCACCACAACAGAGAGCACTTTAAATTCAGTT
GCTATCACAAGTATGAAAACTACTCTATCTTCCCAAATAACCAGTGCTGCCTTGGTGACC
CCTCAAACAACTACTACTAGCATAGTTTCTTCGGCCCCAATTCAAACAGCTATCACTAGT
ACTCTTTCGCCAGCAACGAAGAGTTCTTCTGTCGTTTCCCTACAGACAGCTACTACTAGT
ACGCTTTCCCCAACAACGACCAGTACAAGCTCAGGTAGTACAAGCTCAGGTAGTACAAGC
TCAGACAGTACAGCTCGTACATTGGCTAAAGAATTGAATGCTCAATATGCGGCTGGTAAA
TTGAACGGTAAATCTACCTGTACTGAAGGTGAAATTGCATGCTCTGCTGATGGGAAGTTC
GCCGTTTGTGATCATAGCGCTTGGGTTTACATGGAATGTGCTTCTGGAACCACATGTTAT
GCTTATGACTCCGGCGACTCAGTCTATACCCAATGTAATTTCTCTTATTTGGAAAGCAAT
TACTTTTAA
Promoter Sequence
Download FASTA
>CTS1 YLR286C
CCAATGAGGAGGTAAAAGAAGAACAGGCTGCATTAGTTGCAGTAACTAAAAAAGTTCTTA
TCCAAATGAGTAAACTATATGAAGGTGATCCAAAAAGAAAGAAATGGATTGACACATGGG
AGATAAAATTCAATGAATTGTTTTAGTATATTTTCTCTGAATGTTACAGTGCATGGTATA
TAATCAGTCTTGTTTAGAAATTCATGCTAAAACGGATACAAGAGATATCATTGTGTAGCT
GCGAGATCCACGGTCACGGCAAAAACCATGTCCATTAATATAGTGGTTGGTTGGTGGGAA
TATGTGGGATATCCTCAACAAAATCGAACTTATATACGTCATTCTCGTTAACAAATTCAA
ATTTTGTAGTTGTCATAGTAACGCAAAATGAGATGCGTGGGTGTGATTCCTGCTTGTTGG
TATTTTTCTTTGCCGCTGGTGAAAAATTGGAAATGCTGGTCCCTTGAAAAAATAACCAGC
CTCGCCTTAACAGATATGTGCGAGTAAATATGAGTTTCTAACGTGCAATGTTTGGTGTTT
GTTTATTTGTTTATGTGTTTCAGATGTTGAGTAAACATTAGCATTGGTGTAAGAACTAAG
CCCCTCGATGGTTCGGTGCAGGATTCAAGGAACAAAAAAAAACTAATATGGACGGAAGTA
TTTGGCTTCATAGGCATTGGTCAAAGATATAAAAAGATGCAGGTATTAGGTCCTTGGATG
GAGGAAAAACGTCTCACTTACCTTTCCTTGTATAATTTATAGAATGGACAACAACAATAC
ATTACATTAAGATTATATCAGTCAAGTTTTTTCATAACATTGAAGATCTTTCACTCATTT
AAGACTCAATAACATAAAAAAAATAAACCTGTCATTCCTTTGAACCTTTTTATATCCAAA
AATAATAACTGTCGCTCGTTTCACAACCTACCTTTTTTAAAACCACTCTTTTTCCAATAC
ATTGAAATTCTAATTTAAATATAAAATAATTAATAATAGA
Chr coordinates Chr XII from 710136-708448
w3c xhtml validator w3c css validator