Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SEC72
Systematic Name YLR292C
Alias SEC67, SIM2
Strain S288c
Description Non-essential subunit of Sec63 complex; with Sec61 complex, Kar2p/BiP and Lhs1p forms a channel competent for SRP-dependent and post-translational SRP-independent protein targeting and translocation into the ER; other members are Sec63p, Sec62p, and Sec66p
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SEC72 YLR292C
GGTGGTACTGGTAAGACCACTTTTGTCAAGAGACATTTGACCGGTGAATTCGAAAAGAAG
TACATCGCCACCATTGGTGTCGAAGTGCATCCTTTATCCTTTTACACCAACTTCGGTGAA
ATTAAATTTGATGTCTGGGATACTGCCGGCCAAGAAAAATTCGGTGGTTTAAGAGACGGT
TACTACATTAACGCCCAATGTGCCATCATCATGTTCGATGTTACTTCCAGAATTACTTAC
AAGAACGTTCCAAACTGGCACAGGGATTTAGTCCGTGTTTGTGAAAACATCCCAATTGTC
TTGTGTGGTAACAAGGTCGATGTCAAAGAAAGAAAGGTCAAGGCCAAGACTATCACTTTC
CACAGAAAGAAAAACTTGCAATACTACGATATTTCTGCCAAGTCCAACTACAACTTTGAA
AAGCCTTTCTTATGGTTGGCCAGAAAATTGGCTGGTAACCCACAATTAGAATTTGTTGCT
TCTCCAGCTTTAGCCCCACCAGAAGTCCAAGTCGATGAACAATTGATGCAACAATACCAA
CAAGAAATGGAACAAGCTACTGCTTTGCCATTGCCTGATGAAGATGATGCTGATTTATAA
GGGACAAACGAGAACAAGCTTTCTTTTTTCCCTACCCTAAACTGTATACATATTTACATT
CATCTCGATATAGAAATTCAATAAAAATCCACATGATTTTGAAGATTTTATAATTGCAAC
AAGAAAACACAAACTAACTGGTACTCCTGTCTTTTATAAAACAGATTTAAATATATAACA
AATAGTTGAATGTGAATATGCTGTGATTTAAGTATATTTAAACGTATTTGGCTTGTCTAA
TATTATATTTTTTAGATCGTTTATGGATCGTTTCAAACGGATGTAGGAGCACACGTAACA
ATTAGATTATATCTTTGAACATAAAACCAATAGCCTTAAAATCAAAGAAACGTCTCCTTC
AACTTGCGTTAAAGGCATACCAAAGCAAGCTTATTCAACC
Chr coordinates Chr XII from 720370-719789
w3c xhtml validator w3c css validator