Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YLR297W
Systematic Name YLR297W
Strain S288c
Description Protein of unknown function; green fluorescent protein (GFP)-fusion protein localizes to the vacuole; not an essential gene; induced by treatment with 8-methoxypsoralen and UVA irradiation; relocalizes from nucleus to vacuole upon DNA replication stress; YLR297W has a paralog, YOR186W, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YLR297W YLR297W
ATAAAGGAACCACTATTATCCCTTTTTGGTAATGAAAAACAACACTCTTCCGGTACGACA
GCCGCTGCGGCAATTACTTTTCCCCAAAAGCTCATAATCGATCAATTAACGCGTAAACGA
AAAACAAAAAAAAAAAAAATACGTAAATTAGGTCTTCATACGAGCGTTTTTTTTTTTTTG
AGGATCGTTTGCATGTCTAGCGCGGCAAGCGTGTTTACAGGCATTCGTTGTGTGTTCATG
TTTAGAACAAATGCTAAGTGATAATTATAACTGAATCCTACTCATAACAATTGCACACCT
TGTCGCTTTCTTTTACTCAAGGGCGACAAAACGAGAACACATCCTCGAGCTATAGCCGCG
GGGCCTGCTGACTCGAAACTCGTCGGGCTTTGCAGCCATAATCCAGGGCAGTGGCCGCAT
CGTTCGGGTCGAATGGAGGGCTAGCTACTTGTGATTTCCGAAAAACGGACTGCAAAAAAT
GAGGAACAATAGAACACCGCGCGCTTTCTTTTGGGGCTGTCTGGAGAAACCAGTGAAAAG
TGCGCACGCGTATTGCGGCTTAAAAAGATACCCGTCCATTCAAGAATGGCCGATTTAACA
GAAAAGAGTAAAGAGATGAGTTTTGCGAGATCAGAAACAAAAACAAAAAGGAAAAAAAAA
GGAAATTTTTTTGGGAGAAGGAAAAAAGGGTTAAGTCTGTAGAGAAACTCCGTAGTTCCC
TTCTGTATTACTAATTGGTTACCAAGTAATAAATACCTGAGAGTAGTAATATATAAAAGA
GAAATCGTATAAGGACCGTGTTAAATTTATATATATTAAGGAAGTCTTTCGGTTGGTAGT
GTGAGATAACTAATTCTTTTTGGAGAGCCTTCTTCTTTGCTCTATCGTGGTAATAATCTA
CATATTCTCACAATCGCACACGTACGCTTTCTCTCTCACAAGTAACAAATTATTCTTTTT
GCATTATAGACTACGTACGATAAAAATATAAAAACAGAAA
Chr coordinates Chr XII from 724044-724433
w3c xhtml validator w3c css validator