Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name EXG1
Systematic Name YLR300W
Alias BGL1, SCW6
Strain S288c
Description Major exo-1,3-beta-glucanase of the cell wall, involved in cell wall beta-glucan assembly; exists as three differentially glycosylated isoenzymes
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>EXG1 YLR300W
TCCCAAGAGCGTAGTTAATGCTATACGCAATGTCAGGGGAGAATGGCATGCGGTGAGTGA
CTATTGGAGAAAAAGAGGAATCTCCTCCGTATACTAAGATGTGGGGTAAGAATGGTACTG
TAATATAGTTCAAGATAATAGTACGTAATGTAGGGAGCCTGCTTCTGTGGTATATAAATA
AATACTGGGCTTGCGTTTATTTTTAAAGAATCAATATTTACTTTTCATTAACAAAGGGCA
TACGCCCTTAAAACAAAACAAAAAATCCAGATCATGCGAGCTTTGCCTTTTTCAGTAAGT
TTCCCTACCTTGCAGCCGAGACGCGACTTCGGAACGATGCCAGCATACGTATTTACCATT
ATTAAAAAAATCTGATGGCTTGATACTGCGCGTTTCTTTTTATAGCATTAATACGCACAC
ATACGCGCATTGTTGTTTACTATAAATAAACCGTGGGGACCTGACCCAGTCATCCTCCCT
GTGTTTACAGTGCGGTGCACACGAGCCTGAGACAAGCCCGTAACCAGGCGCGTTGCCGCA
AATACAGAGGCGCCCCAGACAACACCGCAGTGTGAAGCACTGTCAATTTAAAACCGTGGC
TTGCTGGAGATGCCCAGACCAACCCTGTTGGGTTTTTCTCTCGAGCACGCCGTTATAATT
TTAGCGTGTTCCGTACCTGTGTGCACATCAATAAGCGGTGTAACAAACTTGAACTTGCCA
TCTCATATCGTCATATGAGCAGTTGCAGAGAAAGGCACTTTAAATAAAAAGGCGTGGATG
ATAAAAAATGTATATAAGTTGGATGGATTTTTGGGAAAAAGTAATGTTTTTGCAGACGTT
TTAAATACTCCCTCCCTTTTCTTAGTAATTTTTATTATGTATTGACTAAGTCAAAAATAA
CTATAGAAAACTAAAGTTTACGAGAGGACCCAAAAGTTTTGAATAACACGTGCCTTTGAT
TTTTTGTTTACTTTCTTTTTCTAGTTAATTACCAACTAAA
Chr coordinates Chr XII from 728955-730301
w3c xhtml validator w3c css validator