Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MET17
Systematic Name YLR303W
Alias MET15, MET25
Strain S288c
Description Methionine and cysteine synthase (O-acetyl homoserine-O-acetyl serine sulfhydrylase), required for sulfur amino acid synthesis
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MET17 YLR303W
ATTGAATATCACGCTTAATAAAGGAGAATAAATCGTTTTCTACTTTCTTCTGCTGCTATA
ATAAGCACCTATGGGATCTATATAGTATTTTTATAACGATAGACTTTATAAAAGAAAATA
CCTAAGTGAAAATTTGGTGAATTTTGAGATAATTGTTGGGATTCCATTTTTAATAAGGCA
ATAATATTAGGTATGTAGAATATACTAGAAGTTCTCCTCGAGGATTTAGGAATCCATAAA
AGGGAATCTGCAATTCTACACAATTCTATAAATATTATTATCATCGTTTTATATGTTAAT
ATTCATTGATCCTATTACATTATCAATCCTTGCGTTTCAGCTTCCACTAATTTAGATGAC
TATTTCTCATCATTTGCGTCATCTTCTAACACCGTATATGATAATATACTAGTAACGTAA
ATACTAGTTAGTAGATGATAGTTGATTTTTATTCCAACACTAAGAAATAATTTCGCCATT
TCTTGAATGTATTTAAAGATATTTAATGCTATAATAGACATTTAAATCCAATTCTTCCAA
CATACAATGGGAGTTTGGCCGAGTGGTTTAAGGCGTCAGATTTAGGTGGATTTAACCTCT
AAAATCTCTGATATCTTCGGATGCAAGGGTTCGAATCCCTTAGCTCTCATTATTTTTTGC
TTTTTCTCTTGAGGTCACATGATCGCAAAATGGCAAATGGCACGTGAAGCTGTCGATATT
GGGGAACTGTGGTGGTTGGCAAATGACTAATTAAGTTAGTCAAGGCGCCATCCTCATGAA
AACTGTGTAACATAATAACCGAAGTGTCGAAAAGGTGGCACCTTGTCCAATTGAACACGC
TCGATGAAAAAAATAAGATATATATAAGGTTAAGTAAAGCGTCTGTTAGAAAGGAAGTTT
TTCCTTTTTCTTGCTCTCTTGTCTTTTCATCTACTATTTCCTTCGTGTAATACAGGGTCG
TCAGATACATAGATACAATTCTATTACCCCCATCCATACA
Chr coordinates Chr XII from 732542-733876
w3c xhtml validator w3c css validator