Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CDA1
Systematic Name YLR307W
Strain S288c
Description Chitin deacetylase, together with Cda2p involved in the biosynthesis ascospore wall component, chitosan; required for proper rigidity of the ascospore wall
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CDA1 YLR307W
GAACGTTTGCCTAAATATTCTTCGAGAAGACTGGTCGCCAGCTCTAGATTTGCAGAGTAT
TATAACCGGGCTTCTTTTCTTGTTCTTGGAGCCTAATCCCAATGACCCGTTAAACAAGGA
TGCAGCAAAGTTACTGTGTGAGGGTGAGAAAGAATTTGCTGAAGCTGTGAGATTGACCAT
GTCTGGAGGTTCAATTGAACATGTCAAATATGATAACATAGTTTCTCCTTGAGTCAAGTT
CAGAGTAATTTTCGGTTGATTTGATTATATATAAACAATAAAATTATAGATAATTGTGAC
ATACTAGGCGAGTTGTCGCCTTGGTAACATCTTGCTACCGCCATCTTCTGTTAGTTTACG
CCTTATGACCAACATTCCTTATATTCTCGTTCAAACTTTTGTCTCGATATTTTGCAGGTA
CCTGTAGAACTTAATGTGTTCTATTCAAAATAAGTATAAAATTTCTGGCCAGTAAAGGCA
AACAAAACATAAAGATATTAATACGAAAAATTTCTTGAAGAAAACAAAAAATACTTCTTA
TAATAAAGAAACAGCGAAGCCATGGCTATTGACAAGATAATCAGGAAGGTGAGATACCCT
GGATAGAAGACTAAGAGAGAGCAGGAAGTTGAAGAACGCAATCTCAGCTATCGCTAATTC
TTACAAAAAATAAAGATATTACAACTATGGAAGAAAAAAATGAATGACTATACTAGTTAG
TAATATTTAACAAGATAACGCTTTCTATTTTCTGTAAAAAAAATTCTGTCTCATGCACTT
GGAAGCAGCTTCAACATTTCTCTTTTCCAGATGTCACATTTTCCGGACCGGCCGTCATTC
AATCGCAATTAAAAGAGAAAAATACCAACAAGTGGGTTGATTTACTTTTGTGTTTTCAAA
AAGACCAATAGTTCTAACAAAGTAGATGCTTAGAAGTAAGCAAAGTGGAATATAGAGAAA
CAAAATTAAGTGATAGATTTACTTTTACACAAGAAAAGAG
Chr coordinates Chr XII from 745620-746525
w3c xhtml validator w3c css validator