Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ATG39
Systematic Name YLR312C
Alias QNQ1
Strain S288c
Description Putative protein of unknown function
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ATG39 YLR312C
CTGTAGTTTCAAAAACTGTGCTCCTAGCAGATTCAGTTTTTCGTTGTATGGCTTTGACCC
GTGTGCGAACGACTTATGTGTTAAACACTGCAAAATCAGTTCGTTTGATAAATTTATTCC
GTACTTGGGCAATTGTAGTATGGATCTAACTTTGTCTTGACACTCTTTTGCGTTAACTTC
AGTAAAGAGTACCCCGCTAGGATTTCTCAAGTACGACTCTGGATCTCGTCTCAAACCATT
AATTCTCGGACCCTTATGAAGGTATATGACTGTTCTAACGCTTTGTAAATTGCAGTTCAA
AGCAGTAACGGGTCTCCGCAAGGAACGCGATATAAACATCATGCTATTTTCCATGTTTCC
GAGCTTGTCTACTCTTTACTTTCCATCTACCGTTATAGTTTTATATCTCGCTCTTGTTCA
TACTATATGCAAGTTTTCCAACGCTTCCCATAGCATAAGCTTGGATAGCGAAACCTAAGT
TGTTTTTTTTTTCAAAAACTCATCAATTAGGGCAAACTTGAATAGTCAGCTAGGTCATAT
ATTTAAAATCAATTAGCCCTATGACTACATTAGGTTTATTGTTAGGTCTTTACGGCTGCA
TATTTGCTTTCGCCGTTCGGCGGGGTCCTGCGACGATTTCTGCGCGGTCTTGTATGGGTG
GAGTTGACAGTTAACCCTCCGGACCCCCTACCCCGGTGTGCCCCCGGTCCATCTATCCAT
TTTGCGGTAACCCCTTTGCGCGACAGCTGCTTATCAAGGTACCTGGATCGAGCCATAAAA
ATTGATCTACACAGATGAGATGGGGCATTGGGATATATTATTAGTCGGAGTATCATTATA
GTTATTCAGTTTTATGCAGGTTACTGGCCAAACGTTTTTCTTCATTTGGAATAATCGTTT
AGGAGCTACTGTTCCGGTATAAAGTAACAAGCACAGTAGCAGAGTAATACGCAGTGACGA
TAATAGAGACTAGTAAAACAGTCGAGTTGTCGGACCTAAA
Chr coordinates Chr XII from 758833-757637
w3c xhtml validator w3c css validator