Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CDC3
Systematic Name YLR314C
Strain S288c
Description Component of the septin ring of the mother-bud neck that is required for cytokinesis; septins recruit proteins to the neck and can act as a barrier to diffusion at the membrane, and they comprise the 10nm filaments seen with EM
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CDC3 YLR314C
ATCATCCAGAATCTGCAAACGCTGTTGCAACAGGTCATTAATCTTGTACAGCGCGTCGAT
CAGTGTCTCGAGGCTAAGGGAGTGTGATAGTTGCTCGCTTTCCAGAAATCGCAGTAATCT
AGAGCGCAACGTTATGAAAAACTGCTTGATTCGTGCTTCTAACTCAGAGGTCACTCGCGC
ATCCCTGGCCTGAAGCAATTCGTACCAATGTTGCAGTTGTTGCTCGTCGCTCGTGTACGA
CTGTAGTTGCTGCTTGAACTCTTGAAAACTTATCAGAGTAGTGAGTAGCGAATCCGAAAC
ATAGTTATGCAGCAGCTGTTCAGAGTTCATTTATAATGGTAATTTCAAAGCAAGATTGGG
AGCACAATTGTCAAATCTATGATTATTTTGTTGCGTTATACCCAGCTTTTGGGCTTTTTC
GAGAACGATCTTCGTTGTTTTTCGCTGTTTCTCCGCGAAGCGGGCAGCGGCGACGGTAAT
ATTGGCTGTTAATCTATTGTTATCTTGTAGTTGTACAAGATCATTCCTTTAATTCTATAT
ATTAACTGTTCGTGGCGTAACAAGAAATCGATTCTGACATCAAATGGAAGACATCAGCAG
TTACACTAGTGGTGCAGGAAAGGCACCGCAAGGGAGTGCAAGAAGCTGTGAGAAACAACT
TTATATAACTTGCTGCTTGATAATTGTGACAGAATATTCTCGCACCTTGCAAACATATAT
AGCAGCACCTCTAGATTTCTCCTTCCTTCCTTTCGTAAAAAGGAACCACCTGGGCGGCTA
ATTTAGTATTTTCGTCTTTTATGATCTACGTGTGTAATGATATGGTGGGGGCGTGTTTTC
GCTTCCCATTTTTTGCCATTTTTTGTCTCGGTTTTAGGAATTGCGTTTTGTGTTGTTTTG
TGTATTAAGTTAAAATCTCTCGAGGAAAGCAGATCAAGAAAATATCAAATCCAGGATCAC
ACGACAACTGAACGATTACATCGGCCTATAATACGTTGCC
Chr coordinates Chr XII from 764137-762575
w3c xhtml validator w3c css validator