Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPL38
Systematic Name YLR325C
Alias eL38, L38, L38e
Strain S288c
Description Protein component of the large (60S) ribosomal subunit, has similarity to rat L38 ribosomal protein
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPL38 YLR325C
GCTTTGTTTTGGACCTTTTTCCACGCTTTACTTTCATCCTTAGTGCAATAATATGGCAGT
CTGCGGCGGTGCTTTTTACCATCTTTATTCGTTTCATAAAACGGATCCCTGGTTGGCTGG
AAATGCTGTTCTGCGAACTCTTGATATTGATCTTCTAAGTAATCTTGGCCTAGACCAAGC
AACGTGCTCTTAATGAACCCTGACATTTGATATGGTTTCCCCCTTATTTTACTTGATGAT
ATTGCTCCCAGCAGATCCAAGATTTATTTTCAAGTGCTCTTGTCTCACGTATACTACGAC
TTCTATGAAACAAATATATGAGTAGGGAACTGAACAAAAAAGCAAATTCTTCCAATGCTC
TCTAGCTCGCAGTCATGTTATGATCTCATAATCACGTCCCATTCCCGGCTTCTACGCATT
TTTCCACGTATTAGCGCGATTTAAAAAAAGAAAATAGAAACAAATAGCAATAAACAAAAA
GAAAAGTAACGCTATTACATCCACATGTCACAACTACTTTGTGAAGTTGCAATGCGTGAT
TAGTATTATAAAACATCATAGCCTTGCCAAATAAACTCGCTTCCCAGAAAAGACGCCAAA
TTAACTGCCGCTGTTATGTGACAAAACAGGGCATCTCACATATTCGCGTACTGGTGTTCT
TTTAGCTCATTCCGATATTATTCCAAGACGGAATTTTCATCTAGAGAAAATGCATCCGTG
CATTTTCATAAACCCACACAATTAAAATGCCTTGCGAAAAGGAGGACTCGTCCGTGCAAC
TGTTGAAAAAAATAGACGGAGCATCATACGTTCGAGTGGAAAATTATGGAGAGTTTTCCA
AGCTCTATGGCATGTAGAGTCGTGATTGCTGCTGTACGCTTTTGCACAATATTGAATCTT
CAATCTAAAGAATTAAATTTTCTAATTTCAATGTAGAAATATTTCAACTGTTAGTTTTTT
ATTTCAGGTTGAATATAGTACGACAAAATATCAAGGAAAA
Chr coordinates Chr XII from 781379-781143
w3c xhtml validator w3c css validator