Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TMA10
Systematic Name YLR327C
Alias SFL2
Strain S288c
Description Protein of unknown function that associates with ribosomes; protein abundance increases in response to DNA replication stress; TMA10 has a paralog, STF2, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TMA10 YLR327C
GCAGGCATCGCCTTAACCACTCGGCCACTGGGACGGTTGAACAACGATCTAAAAATGAAT
CGTTATATTGTCCAAATTTTGTGTCACATCAAATGCCCATTTGCGCATTCCTATATCCTC
GAGGGAGAACTTCTAGTATATTTTGTACCCCTAATATTAACACCGAATCGACAATGAAAT
AAACGGAATAGCGCAATTTCTGCAAATTTTTACAGTTCATCAACAAGATACATATCTTTC
ATGACAGCTCCTAAAACGACTCTCATGAATGGTAGTACACCTCACGAAAAAGCGTACCAA
AACCGCACACAATAAACGGACTCGAACTGTTATGATCTCGTATTTTCTTGTGCCCCGGGT
CTTACTTCGTCGTGAGGGTGGATGAGCCATCACAATGGGCATTTAGCGTTTTGGTGCAAG
AGCGGGAAGAGGGGCGGCAGTTGGTTGCAATACCAAAAGCAAGTGACTCACTACGGTCCG
ATATTATCTTGCCCTTTCCATTCTCATACGTATGTTTTTTTAGATTATGCACCTTCTTTG
CCACAGTAAATGTGGCGGGGAAGATGTTGAGCTAGCGCCGTGCACAGTGGAAGAGACGGA
GGCGATTGTGGGGTTTCATCGGATTGTGCGGGAAGAAGGCCTACACCGTGTTGAGCCACC
CCCCCCTCAGGAGTAAATTTACACAAACAGTGGTGGTGCCTATGGTGGTATACGAGATAG
TGATAGAAGCTGCTGGATTGGGGTAGAAATTTTGTAGGCGTTTATGGATATGGTATGGAT
ATGGTATGGCTTGAGGTAGGTAATCCAGACACCACTGGAAATATATATAAGGAGAGAGTT
CTGGCAGGTAGATTTGTACTCCTCTCTACCACTTTCTTCTACTCCTTTTATTATGTAATG
TTTATTATAAGCACAGCAAAAACGTTAAATAAATCTAATAAGATTTCATTATAACATAAC
ATTAAAGCACACAAATTTCTAACACAAACACAATTCAAAC
Chr coordinates Chr XII from 783387-783127
w3c xhtml validator w3c css validator