Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TMA10
Systematic Name YLR327C
Alias RBF9, SFL2
Strain S288c
Description Protein of unknown function that associates with ribosomes; putative homolog of the F1F0-ATPase synthase regulator Stf2p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TMA10 YLR327C
GCAGGCATCGCCTTAACCACTCGGCCACTGGGACGGTTGAACAACGATCTAAAAATGAAT
CGTTATATTGTCCAAATTTTGTGTCACATCAAATGCCCATTTGCGCATTCCTATATCCTC
GAGGGAGAACTTCTAGTATATTTTGTACCCCTAATATTAACACCGAATCGACAATGAAAT
AAACGGAATAGCGCAATTTCTGCAAATTTTTACAGTTCATCAACAAGATACATATCTTTC
ATGACAGCTCCTAAAACGACTCTCATGAATGGTAGTACACCTCACGAAAAAGCGTACCAA
AACCGCACACAATAAACGGACTCGAACTGTTATGATCTCGTATTTTCTTGTGCCCCGGGT
CTTACTTCGTCGTGAGGGTGGATGAGCCATCACAATGGGCATTTAGCGTTTTGGTGCAAG
AGCGGGAAGAGGGGCGGCAGTTGGTTGCAATACCAAAAGCAAGTGACTCACTACGGTCCG
ATATTATCTTGCCCTTTCCATTCTCATACGTATGTTTTTTTAGATTATGCACCTTCTTTG
CCACAGTAAATGTGGCGGGGAAGATGTTGAGCTAGCGCCGTGCACAGTGGAAGAGACGGA
GGCGATTGTGGGGTTTCATCGGATTGTGCGGGAAGAAGGCCTACACCGTGTTGAGCCACC
CCCCCCTCAGGAGTAAATTTACACAAACAGTGGTGGTGCCTATGGTGGTATACGAGATAG
TGATAGAAGCTGCTGGATTGGGGTAGAAATTTTGTAGGCGTTTATGGATATGGTATGGAT
ATGGTATGGCTTGAGGTAGGTAATCCAGACACCACTGGAAATATATATAAGGAGAGAGTT
CTGGCAGGTAGATTTGTACTCCTCTCTACCACTTTCTTCTACTCCTTTTATTATGTAATG
TTTATTATAAGCACAGCAAAAACGTTAAATAAATCTAATAAGATTTCATTATAACATAAC
ATTAAAGCACACAAATTTCTAACACAAACACAATTCAAAC
Chr coordinates Chr XII from 783387-783127
w3c xhtml validator w3c css validator