Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name JIP3
Systematic Name YLR331C
Strain S288c
Description Dubious open reading frame, unlikely to encode a protein; not conserved in closely related Saccharomyces species; 98% of ORF overlaps the verified gene MID2
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YLR331C	6323364 upstream sequence, from -1000 to -1, size 1000
TCAAATGGCTGTCAGGTCCTACTATCATACTATTACAATTTTTTTTAAAATGTAATTAAT
GTTAACTTTTTTTAATTAGAGGGTATGTAATGCTAATCCTACATAAGAAGGTGATAATAT
TTGTAAAAATACTAATGAAGTCCACCTACTCAATATCAGAAATATAATTAAGATGGTCAA
TTTACAATAATTGAGGAATGAAAAGTAGCCATAAGCACTAAATGATATGAATGGATATGA
TTAATAATTTCGTGGTGATAATTCGTTACCTTGTTCATCATAGAATTTTTCTTCTATTAT
GTCATTTGACGCAACGCTACTATTTATAGGCTCTCCACCGCTATTGGTATTATTATGGTC
GGCGGTGTTGGCGTTTGGTAATACGCTATCGCTATCTCTTATTCTGACGTCGAAAAGGGA
GCTTTGCTCCATCACATCATCTGCTTCATCTAGGTCTAAACCACCTGCGGACGATGCACT
ACCACCTAATGGTGAATCGGAGTGGTATTCATCACTAACTTTCTTACCCAAAAGCATATA
CCACCATTTCGTAAATTTGTTAGCTCTATATGCCGTAACGACCTTACCATCTGAGTCAAT
AAAGTCCGTCCTTGATGATTGGATACAAAACATGTAAATTAAAGCCAGTATCACCAGAAT
CAGTGGTACACCAATACCAACCACACAACCAATGACGATGTTTCTATTTTTTTTAGAAAG
ACCCGAACTTTTGGATTTATTGCTTGAATCAGCGGTTGCTGATGGTGTGTACGTAACGGT
AGTATAATGATTTGAGAGAATCGTCTTACCGTTAATAATACTGGTGATAGTGCTTCCTTG
ATTATAGGCAGTAGTGGATGGTGTGGAGGAGGTTGAAGGTGCAGAAGTGATTGTTGATGG
GGATGATGAAGAGGACGGCGTTGACGACAGTGAGGATGAAGATGATGTTGACGTTTGCGT
AGAAGACGTCGATGATTCAGAAGTTGCGGATGTCGAAGAG
Chr coordinates
w3c xhtml validator w3c css validator