Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GAS2
Systematic Name YLR343W
Alias 1,3-beta-glucanosyltransferase
Strain S288c
Description 1,3-beta-glucanosyltransferase, involved with Gas4p in spore wall assembly; has similarity to Gas1p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GAS2 YLR343W
AAAAACGATCATGCCAATACAGCCTTCTGGACTGGTAAGTGGTATGGTAAAGGTATGGGT
TACATGGCTTGGACCCAGCCAAGTAGAGAATTAACCGCCAAGGTAATTGAGCTTTCAGAA
TTTGCAGCTGATTTTGTTCTAGGTCATGTGATTTTAATCTGTCAACTGCCACTCATTATA
ATCCCAAAAATAGATAAATTCCACTCGATTATGCTATTCTGGCTAAAGCCCTCTCGTCAA
ATTCGTCCCCCAATTTACTCTCTGAAGCAAACTCGTTTGCGTAAGCGTATGGTCAAGAAG
TACTGCTCTTTGTACTTTTTAGTATTGGCTATTTTTGCAGGATGCATTATTGGTCCTGCT
GTAGCCTCTGCTAAGATCCACAAACACATTGGAGATTCATTGGATGGCGTTGTTCACAAT
CTATTCCAACCAATAAATACAACCAATAATGACACTGGTTCCCAAATGTCAACTTATCAA
AGTCACTACTATACTCATACGCCATCATTAAAGACCTGGTCAACTATAAAATAATACAAT
CAATACTTGCTTGAACGCTTGATTTTACTGATATTCTATCCAAAAGCAAGTAGACCAGAA
ACTCTCAAGATGTTGCAAATACCGTTCGATGTTTTTGGTTTAGATTGTTTTAATGTTGAT
GCTTTTTTACTTATTTTTGGAAGCGTCTTTTTAATTTAGTTTTATATTATAGGTATATGA
ATGTGTTTATGCCAATAAGGGTTTTTTTGTACAGTTATGTGATTATAAACAGTCTTTTGT
CTAGTTTTTTTCACCAGTATCGGCCTCTATTTATAAAAAACGGAGCAGCTTTCGGTGTCA
GTAATTCTGAAAAAATTTGTGTCACTCTGATTGTAAATGAATTAATTTAGCTAGATAGTT
GCGAGCCCCAACGAGAAGATTGTCAGACAAAGACAACATTCAACAACCTACATCCGTTAC
TATTCGTTAACTCGAGGTACTTGAAACTTTTCAGTTAAGT
Chr coordinates Chr XII from 816094-817761
w3c xhtml validator w3c css validator