Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPL26A
Systematic Name YLR344W
Alias L24, L26A, L33A, uL24, YL33
Strain S288c
Description Protein component of the large (60S) ribosomal subunit, nearly identical to Rpl26Bp and has similarity to E. coli L24 and rat L26 ribosomal proteins; binds to 5.8S rRNA
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPL26A YLR344W
CATAACTCATGTCATCATCTAACACCGTATATGATAATATATTGATAGCATAACCATTAG
TTGATAGGTGATGGTGGAATTTTATTTCAACAGTTTTATACCTCTCTTATATAAGCACAG
GAAGGTCCATATCCACATTTAAACTTGATTAATACTTTTTTTTATACCTTTAACTATCAT
CATCAATAATTTCTTTTCTGAAAGTACGACATCAAAGTCGCCGAGTTTTGTCTTCGGAAT
AAATACTAGGTCAGATGAATAAAGAGCAGGAATTTACTATCTCTGATAATTTATTATGCT
CCTCTAGTGCAATGGTTAGCATGCATTCTTCCGGTGGCTGTGATCCGGGTTCGAGTCCCG
GGAGGAGCTTTTAATTTTTTAGCGCACTATTCTAATTTTTAAGGAAAAAGCATATTTCCG
AGTCAGTGCATAGAAAGAACGGAGGCTACGATGCCAGCACAGTGTCTATAAAGTCAAGAA
ATACATTCAAACTCTTCGCGTAAGGGCTGTCAATTTTTCATTTCCCTCAAAGTTAATGCG
CAAGAGTTAGGATGATCTTGATTATTAGTTATTTGTTTGTTCCATCAATTATGCCGACGT
CCATGAATGCTATTGAAGTATCGATTACTTATGCTATTCTATTGTATTTGAGCCGGCGGC
TAGTAAACAAGACAGCATACCTTTCCAACATCCGTACATATTGATTATTGTATCTATGAT
TTTCATGTAATGTATGGGTTAACTAATCCTTTCTCTTCTTTTTTTTTTTTCTGAAAATCA
GTAGCTAGAGGAACCTGTTCGTGAAAGATATGGAATATTCCGTCTAGGGAAGAGCCGAGA
GCTGAGAGCAGTATCCATCGGATGGAATCTTGCCTGGATGCGTAACGACGACAGCTTGTC
TAGAAGGCGAAGTACAAGATACTAAGAAGACTATAACAACAGAAGACAATTTTGTAGTGC
GATTCTATATTATTGACGTAACCAACAAAAAAGTATCAGA
Chr coordinates Chr XII from 819312-819330,819778-820142
w3c xhtml validator w3c css validator