Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name LUG1
Systematic Name YLR352W
Strain S288c
Description Putative protein of unknown function with similarity to F-box proteins; interacts with Skp1p and Cdc53p; YLR352W is not an essential gene
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>LUG1 YLR352W
CAGAAATTGAACTGACGTCGAAGGCTCTTTCGGATTGATAACTTCTGAATACTTTCTAAA
CTGATCAGTGGAGTACGGAGAATTGAAGCATTCTGGCAATACGACCAACTTGGTATCCGG
CTGTTCCTTCATAGCCCTTTCAATGAACGTTGCAGCCCTTTGAAGATTGGCCATTTTGTC
AGGACTCGAGCCTGACAGTTGGACCAACGCAACTTTAATTTTTTGTGAAAGAATCTTCGA
AGCACTCATACTGGCGATCTTCACGCCCTCCTGCTACTACAAAAGCTGTGTTTTTACAAG
AATCAAATTAAGTTAGCAAGATATCATACAACATTATTGATAATTTTAATATCGTGTTCG
TACCTGATGACGTATCTGTGCATTGATAAGGCCCGCATGGTTTCAGAAAGCAGAGCGGGA
CGATTCCAAATTAGTGGCCTTGTGCTTTGCATGTCAATTGTGTTACCTTCAGCTCGTGGA
TTTGTTTTATCAATACACAGTCTACAGTCAAGAATTTTTTTTTATCAATTTGTGCGTTCG
AGCGTATAAAATAGCCGCTGTAGCTACTTAAGTTCCTGTTCAGCGATAGTTTTTTTCCAT
CACACGTACTATGGCACCAACTTTGTACTATTCCTTCCCCGTTTACTCAATTCTTGAAGC
CAATTTGTACAATTCCCCATTAGAGTCAAATAAAAGGATGCCTCACGGAGGTATGTTACC
CGCGCTATTTCACATGGCTCATTGAATTAGAGGTGGAATTTGGTGTACCCTCCCCTCCTC
ATCTGATGAAGTAGTGATCCGACAATTCTTAAAAGTTGTAGACATTACTCTTACCACCAA
CTAAGTTGTATTTATATTGCTACCCTTATCCTTTTATATCTAACTAGCGCTTATAAGGTT
GGGGCAATACTAAAACTGTGATCTTATTCAGCTCATTAAATACGTGGCAGTACGTACCCT
ATTAGAAACAATAGGAAACAACAGAGTCGGAAGAAGCCAA
Chr coordinates Chr XII from 831116-833539
w3c xhtml validator w3c css validator